Prupe.7G035900_v2.0.a1

RIBOSOMAL protein

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
Physical Location & Seq
Reverse (-)
6605097 .. 6606838
1742 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G035900.1

Sequence Viewer

Length: 210 bp
ATGCCGAAGCAAATCCATGAGATTAAGGATTTCCTTCTAACTGCAAGAAGGAAGGATGCACGCTCTGTCAAAATCAAGAGGAGCAAAGATGCAGTCAAGTTTAAGGTTCGATGCTCCAAGTACCTTTACACACTTTGTGTGTTTGATACCGAGAAGGCCGACAAGTTGAAGCAATCCCTTCCTCCAGGTTTGAGCGTGCAGGACCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

8.02

Weight (kDa)

9.9

Isoelectric Point (pI)

54.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 137
AfaI GTAC 1 cut(s) 122
AgsI TTSAA 1 cut(s) 169
AjnI CCWGG 1 cut(s) 184
AlwNI CAGNNNCTG 1 cut(s) 205
AoxI GGCC 1 cut(s) 156
ArsI GACNNNNNNTTYG 2 cut(s) 78, 110
AspS9I GGNCC 1 cut(s) 202
AvaII GGWCC 1 cut(s) 202
BciT130I CCWGG 1 cut(s) 186
Bme1390I CCNGG 1 cut(s) 186
Bme18I GGWCC 1 cut(s) 202
BmgT120I GGNCC 1 cut(s) 202
BmrFI CCNGG 1 cut(s) 186
BmsI GCATC 3 cut(s) 46, 79, 101
BpmI CTGGAG 1 cut(s) 168
BseBI CCWGG 1 cut(s) 186
BseGI GGATG 1 cut(s) 61
BseRI GAGGAG 1 cut(s) 94
BshFI GGCC 1 cut(s) 158
BsnI GGCC 1 cut(s) 158
BspANI GGCC 1 cut(s) 158
Bst2UI CCWGG 1 cut(s) 186
BstC8I GCNNGC 2 cut(s) 61, 197
BstF5I GGATG 1 cut(s) 61
BstNI CCWGG 1 cut(s) 186
BstSCI CCNGG 1 cut(s) 184
BsuRI GGCC 1 cut(s) 158
BtsCI GGATG 1 cut(s) 61
Cac8I GCNNGC 2 cut(s) 61, 197
CaiI CAGNNNCTG 1 cut(s) 205
Cfr13I GGNCC 1 cut(s) 202
Csp6I GTAC 1 cut(s) 121
CviAII CATG 1 cut(s) 17
CviJI RGCY 1 cut(s) 158
CviKI_1 RGCY 1 cut(s) 158
CviQI GTAC 1 cut(s) 121
DraIII CACNNNGTG 1 cut(s) 137
Eco47I GGWCC 1 cut(s) 202
EcoO109I RGGNCCY 1 cut(s) 202
EcoRII CCWGG 1 cut(s) 184
FaeI CATG 1 cut(s) 20
FaiI YATR 1 cut(s) 18
FatI CATG 1 cut(s) 16
FokI GGATG 1 cut(s) 68
GsuI CTGGAG 1 cut(s) 168
HaeIII GGCC 1 cut(s) 158
Hin1II CATG 1 cut(s) 20
Hpy188III TCNNGA 1 cut(s) 76
HpyAV CCTTC 5 cut(s) 42, 44, 46, 148, 188
HpyCH4V TGCA 4 cut(s) 44, 59, 92, 199
Hsp92II CATG 1 cut(s) 20
LmnI GCTCC 2 cut(s) 81, 119
LpnPI CCDG 3 cut(s) 171, 185, 198
LweI GCATC 3 cut(s) 46, 79, 101
MnlI CCTC 2 cut(s) 72, 192
MseI TTAA 2 cut(s) 24, 102
MspR9I CCNGG 1 cut(s) 186
MvaI CCWGG 1 cut(s) 186
NlaIII CATG 1 cut(s) 20
PpuMI RGGWCCY 1 cut(s) 202
Psp5II RGGWCCY 1 cut(s) 202
Psp6I CCWGG 1 cut(s) 184
PspGI CCWGG 1 cut(s) 184
PspPI GGNCC 1 cut(s) 202
PspPPI RGGWCCY 1 cut(s) 202
PstNI CAGNNNCTG 1 cut(s) 205
RsaI GTAC 1 cut(s) 122
RsaNI GTAC 1 cut(s) 121
SaqAI TTAA 2 cut(s) 24, 102
Sau96I GGNCC 1 cut(s) 202
ScrFI CCNGG 1 cut(s) 186
SetI ASST 4 cut(s) 108, 126, 190, 207
SfaNI GCATC 3 cut(s) 46, 79, 101
SinI GGWCC 1 cut(s) 202
StyD4I CCNGG 1 cut(s) 184
TaqI TCGA 1 cut(s) 109
Tru1I TTAA 2 cut(s) 24, 102
Tru9I TTAA 2 cut(s) 24, 102
VpaK11BI GGWCC 1 cut(s) 202
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.