FvH4_5g01071

Belongs to the cytochrome P450 family

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
Physical Location & Seq
Reverse (-)
660501 .. 660836
336 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g01071.t1

Sequence Viewer

Length: 336 bp
ATGGCCAGGGAGTTCAAGGAGATGGTGCATAATATTATGATAGAGGCTGGAAAACCAAACTTGGCCGACTATTTTCCACTGCTTAGGAAGATTGATCCTAATGGTAGAAGAAGGAGAATGACAAAGTATTTTGGAAAGATTTTGGATCTGATTCACATTATAGTTGAGCAAAGGTTGGAGCTGAGAAAAGTGACCAACTCTGCAACAAATGGTGATGTGTTGGATACCCTTCTCAACATTACAGAAGAAAACAGTGAGGAGATCAGCACAAATCAAATCTATCAACTAATAATGGTCAGTTTCCATTATATTCTTGATATTATTGTCAAATTTTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

112

Amino Acids

13.07

Weight (kDa)

6.84

Isoelectric Point (pI)

52.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 89, 153
AcoI YGGCCR 2 cut(s) 3, 63
AcsI RAATTY 1 cut(s) 329
AgsI TTSAA 1 cut(s) 16
AjnI CCWGG 1 cut(s) 5
AluBI AGCT 1 cut(s) 181
AluI AGCT 1 cut(s) 181
AlwI GGATC 2 cut(s) 89, 153
AoxI GGCC 2 cut(s) 3, 63
ApoI RAATTY 1 cut(s) 329
AsuHPI GGTGA 1 cut(s) 224
BalI TGGCCA 1 cut(s) 5
BccI CCATC 1 cut(s) 16
BciT130I CCWGG 1 cut(s) 7
BciVI GTATCC 1 cut(s) 217
BfuI GTATCC 1 cut(s) 217
Bme1390I CCNGG 1 cut(s) 7
BmrFI CCNGG 1 cut(s) 7
Bpu10I CCTNAGC 1 cut(s) 83
BsaJI CCNNGG 1 cut(s) 6
BseBI CCWGG 1 cut(s) 7
BseDI CCNNGG 1 cut(s) 6
BseMII CTCAG 1 cut(s) 173
BseRI GAGGAG 1 cut(s) 272
BshFI GGCC 2 cut(s) 5, 65
BsnI GGCC 2 cut(s) 5, 65
Bsp143I GATC 3 cut(s) 94, 145, 261
BspANI GGCC 2 cut(s) 5, 65
BspCNI CTCAG 1 cut(s) 174
BspPI GGATC 2 cut(s) 89, 153
BssECI CCNNGG 1 cut(s) 6
BssMI GATC 3 cut(s) 94, 145, 261
Bst2UI CCWGG 1 cut(s) 7
Bst4CI ACNGT 1 cut(s) 254
BstDEI CTNAG 2 cut(s) 83, 182
BstKTI GATC 3 cut(s) 97, 148, 264
BstMBI GATC 3 cut(s) 94, 145, 261
BstNI CCWGG 1 cut(s) 7
BstSCI CCNGG 1 cut(s) 5
BstX2I RGATCY 1 cut(s) 145
BstYI RGATCY 1 cut(s) 145
BsuI GTATCC 1 cut(s) 217
BsuRI GGCC 2 cut(s) 5, 65
BtsI GCAGTG 1 cut(s) 77
BtsIMutI CAGTG 2 cut(s) 77, 259
CviJI RGCY 4 cut(s) 5, 47, 65, 181
CviKI_1 RGCY 4 cut(s) 5, 47, 65, 181
DdeI CTNAG 2 cut(s) 83, 182
DpnI GATC 3 cut(s) 96, 147, 263
DpnII GATC 3 cut(s) 94, 145, 261
EaeI YGGCCR 2 cut(s) 3, 63
EcoRII CCWGG 1 cut(s) 5
FaiI YATR 4 cut(s) 30, 38, 161, 309
HaeIII GGCC 2 cut(s) 5, 65
HinfI GANTC 1 cut(s) 151
HphI GGTGA 1 cut(s) 224
Hpy188I TCNGA 1 cut(s) 150
Hpy188III TCNNGA 1 cut(s) 314
HpyAV CCTTC 2 cut(s) 105, 239
HpyCH4III ACNGT 1 cut(s) 254
HpyCH4V TGCA 2 cut(s) 28, 203
HpyF3I CTNAG 2 cut(s) 83, 182
Kzo9I GATC 3 cut(s) 94, 145, 261
LmnI GCTCC 1 cut(s) 178
LpnPI CCDG 2 cut(s) 19, 33
MaeIII GTNAC 1 cut(s) 190
MalI GATC 3 cut(s) 96, 147, 263
MboI GATC 3 cut(s) 94, 145, 261
MboII GAAGA 3 cut(s) 100, 120, 257
MflI RGATCY 1 cut(s) 145
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 1 cut(s) 329
MluNI TGGCCA 1 cut(s) 5
MmeI TCCRAC 2 cut(s) 156, 201
MnlI CCTC 2 cut(s) 37, 250
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 334
Msp20I TGGCCA 1 cut(s) 5
MspR9I CCNGG 1 cut(s) 7
MvaI CCWGG 1 cut(s) 7
NdeII GATC 3 cut(s) 94, 145, 261
NmuCI GTSAC 1 cut(s) 190
PfeI GAWTC 1 cut(s) 151
Psp6I CCWGG 1 cut(s) 5
PspGI CCWGG 1 cut(s) 5
PsuI RGATCY 1 cut(s) 145
SaqAI TTAA 1 cut(s) 334
Sau3AI GATC 3 cut(s) 94, 145, 261
ScrFI CCNGG 1 cut(s) 7
SetI ASST 2 cut(s) 176, 183
SgeI CNNG 6 cut(s) 18, 19, 28, 60, 73, 326
Sse9I AATT 1 cut(s) 329
SspI AATATT 1 cut(s) 34
StyD4I CCNGG 1 cut(s) 5
TaaI ACNGT 1 cut(s) 254
TasI AATT 1 cut(s) 329
TfiI GAWTC 1 cut(s) 151
Tru1I TTAA 1 cut(s) 334
Tru9I TTAA 1 cut(s) 334
TscAI CASTG 2 cut(s) 84, 259
TseFI GTSAC 1 cut(s) 190
Tsp45I GTSAC 1 cut(s) 190
TspRI CASTG 2 cut(s) 84, 259
XapI RAATTY 1 cut(s) 329
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.