FvH4_7g03510

histone-lysine N-methyltransferase, H3 lysine-9 specific

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb7
Physical Location & Seq
Forward (+)
3877545 .. 3882209
4665 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_7g03510.t1

Sequence Viewer

Length: 222 bp
ATGGCAATTTTGAAAGTACGCGAGACTGTGAAGAATGGATTATTTTCTCCAGTCTCAAAGAGATCAAGAGTGAACGATGTTGCAAACTTTCCTAAAGGGTGTGGATCCTTAGATAGAGTGCAAACAGGGAAACATGAAGACCGTGATCCACTGGTTGATCATTCAAAAGAAAATCAAGAAATTTTCCCCTCATCTGGAGAAGTATTGAAGAAGCACTCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.15

Weight (kDa)

9.3

Isoelectric Point (pI)

36.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 21
AclWI GGATC 3 cut(s) 99, 112, 140
AcsI RAATTY 1 cut(s) 180
AfaI GTAC 1 cut(s) 18
AfiI CCNNNNNNNGG 1 cut(s) 194
AgsI TTSAA 3 cut(s) 13, 165, 208
Alw26I GTCTC 2 cut(s) 17, 58
AlwI GGATC 3 cut(s) 99, 112, 140
ApoI RAATTY 1 cut(s) 180
BamHI GGATCC 1 cut(s) 104
BbsI GAAGAC 1 cut(s) 144
BclI TGATCA 1 cut(s) 157
BcoDI GTCTC 2 cut(s) 17, 58
BmiI GGNNCC 1 cut(s) 106
BpiI GAAGAC 1 cut(s) 144
BpmI CTGGAG 2 cut(s) 33, 216
Bsc4I CCNNNNNNNGG 1 cut(s) 194
Bse1I ACTGG 2 cut(s) 50, 156
BseLI CCNNNNNNNGG 1 cut(s) 194
BseNI ACTGG 2 cut(s) 50, 156
Bsh1236I CGCG 1 cut(s) 21
BslI CCNNNNNNNGG 1 cut(s) 194
BsmAI GTCTC 2 cut(s) 17, 58
Bsp143I GATC 4 cut(s) 62, 104, 145, 157
BspFNI CGCG 1 cut(s) 21
BspLI GGNNCC 1 cut(s) 106
BspPI GGATC 3 cut(s) 99, 112, 140
BsrI ACTGG 2 cut(s) 50, 156
BssMI GATC 4 cut(s) 62, 104, 145, 157
Bst4CI ACNGT 2 cut(s) 28, 143
BstDEI CTNAG 2 cut(s) 109, 219
BstFNI CGCG 1 cut(s) 21
BstKTI GATC 4 cut(s) 65, 107, 148, 160
BstMAI GTCTC 2 cut(s) 17, 58
BstMBI GATC 4 cut(s) 62, 104, 145, 157
BstUI CGCG 1 cut(s) 21
BstV2I GAAGAC 1 cut(s) 144
BstX2I RGATCY 1 cut(s) 104
BstYI RGATCY 1 cut(s) 104
BtsIMutI CAGTG 1 cut(s) 149
Csp6I GTAC 1 cut(s) 17
CviAII CATG 1 cut(s) 134
CviQI GTAC 1 cut(s) 17
DdeI CTNAG 2 cut(s) 109, 219
DpnI GATC 4 cut(s) 64, 106, 147, 159
DpnII GATC 4 cut(s) 62, 104, 145, 157
FaeI CATG 1 cut(s) 137
FaiI YATR 1 cut(s) 135
FatI CATG 1 cut(s) 133
FbaI TGATCA 1 cut(s) 157
GsuI CTGGAG 2 cut(s) 33, 216
Hin1II CATG 1 cut(s) 137
Hpy166II GTNNAC 1 cut(s) 73
Hpy188III TCNNGA 3 cut(s) 66, 176, 195
Hpy8I GTNNAC 1 cut(s) 73
HpyCH4III ACNGT 2 cut(s) 28, 143
HpyCH4V TGCA 2 cut(s) 83, 121
HpyF3I CTNAG 2 cut(s) 109, 219
Hsp92II CATG 1 cut(s) 137
Ksp22I TGATCA 1 cut(s) 157
Kzo9I GATC 4 cut(s) 62, 104, 145, 157
LpnPI CCDG 4 cut(s) 63, 111, 137, 180
MalI GATC 4 cut(s) 64, 106, 147, 159
MboI GATC 4 cut(s) 62, 104, 145, 157
MboII GAAGA 3 cut(s) 43, 149, 220
MflI RGATCY 1 cut(s) 104
MluCI AATT 2 cut(s) 6, 180
MnlI CCTC 1 cut(s) 199
MvnI CGCG 1 cut(s) 21
NdeII GATC 4 cut(s) 62, 104, 145, 157
NlaIII CATG 1 cut(s) 137
NlaIV GGNNCC 1 cut(s) 106
PspN4I GGNNCC 1 cut(s) 106
PsuI RGATCY 1 cut(s) 104
RsaI GTAC 1 cut(s) 18
RsaNI GTAC 1 cut(s) 17
Sau3AI GATC 4 cut(s) 62, 104, 145, 157
Sse9I AATT 2 cut(s) 6, 180
TaaI ACNGT 2 cut(s) 28, 143
TasI AATT 2 cut(s) 6, 180
TscAI CASTG 1 cut(s) 156
TspDTI ATGAA 1 cut(s) 150
TspRI CASTG 1 cut(s) 156
XapI RAATTY 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.