Rh1AG071400

histone-lysine N-methyltransferase, H3 lysine-9 specific

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
11968689 .. 11968988
300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG071400.1

Sequence Viewer

Length: 300 bp
ATGCAATGTTCCGATGTATTGATCTATTCTGGTGAAGGCGGAAATTCCCCGTTTAATAAATTGAAACCAACAGATCAGACACTTGAGCGTGGAAACCTTGCATTGAAGAATAGCACAGAAGCACAAACTCCTGTAAGGGTAATCCGCACCTTTAAACTTTCAAAGAGTTCATGTTATGTTTACTATGGTCTATACATCGTAGAGCATCTTTCAAAAGAAAGGGGGCAATTTGGTAAGATGGTTTATAAATTTAGGTTGAGAAGGAAGGCAGGACAACCAGAAATAACATTCAAACTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

11.36

Weight (kDa)

9.8

Isoelectric Point (pI)

30.04

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SAD_SRA PF02182 3 - 92 1.6e-26 SAD/SRA domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 246
AciI CCGC 2 cut(s) 39, 145
AcsI RAATTY 2 cut(s) 43, 248
AgsI TTSAA 5 cut(s) 64, 106, 162, 213, 292
ApoI RAATTY 2 cut(s) 43, 248
AsuHPI GGTGA 1 cut(s) 44
BccI CCATC 1 cut(s) 232
BmsI GCATC 1 cut(s) 214
BpuEI CTTGAG 1 cut(s) 104
Bse3DI GCAATG 1 cut(s) 11
BseMI GCAATG 1 cut(s) 11
Bsp143I GATC 2 cut(s) 21, 73
BspACI CCGC 2 cut(s) 39, 145
BsrDI GCAATG 1 cut(s) 11
BssMI GATC 2 cut(s) 21, 73
Bst4CI ACNGT 1 cut(s) 297
BstKTI GATC 2 cut(s) 24, 76
BstMBI GATC 2 cut(s) 21, 73
CviAII CATG 1 cut(s) 171
DpnI GATC 2 cut(s) 23, 75
DpnII GATC 2 cut(s) 21, 73
DraI TTTAAA 1 cut(s) 154
EciI GGCGGA 1 cut(s) 54
FaeI CATG 1 cut(s) 174
FaiI YATR 5 cut(s) 172, 177, 186, 193, 246
FatI CATG 1 cut(s) 170
Hin1II CATG 1 cut(s) 174
HphI GGTGA 1 cut(s) 44
Hpy166II GTNNAC 1 cut(s) 181
Hpy188I TCNGA 2 cut(s) 13, 78
Hpy8I GTNNAC 1 cut(s) 181
HpyAV CCTTC 3 cut(s) 29, 255, 259
HpyCH4III ACNGT 1 cut(s) 297
HpyCH4V TGCA 2 cut(s) 4, 101
Hsp92II CATG 1 cut(s) 174
Kzo9I GATC 2 cut(s) 21, 73
LpnPI CCDG 4 cut(s) 15, 144, 255, 291
LweI GCATC 1 cut(s) 214
MalI GATC 2 cut(s) 23, 75
MboI GATC 2 cut(s) 21, 73
MboII GAAGA 1 cut(s) 118
MluCI AATT 4 cut(s) 43, 59, 227, 248
MseI TTAA 2 cut(s) 54, 153
NdeII GATC 2 cut(s) 21, 73
NlaIII CATG 1 cut(s) 174
PsiI TTATAA 1 cut(s) 246
SaqAI TTAA 2 cut(s) 54, 153
Sau3AI GATC 2 cut(s) 21, 73
SetI ASST 3 cut(s) 99, 152, 257
SfaNI GCATC 1 cut(s) 214
SgeI CNNG 9 cut(s) 42, 61, 95, 101, 110, 143, 183, 282, 290
SmlI CTYRAG 1 cut(s) 83
SmoI CTYRAG 1 cut(s) 83
Sse9I AATT 4 cut(s) 43, 59, 227, 248
SsiI CCGC 2 cut(s) 39, 145
TaaI ACNGT 1 cut(s) 297
TasI AATT 4 cut(s) 43, 59, 227, 248
Tru1I TTAA 2 cut(s) 54, 153
Tru9I TTAA 2 cut(s) 54, 153
TspDTI ATGAA 1 cut(s) 159
XapI RAATTY 2 cut(s) 43, 248
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.