Rh1BG058400

histone-lysine N-methyltransferase, H3 lysine-9 specific

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
OG0002400
Physical Location & Seq
Reverse (-)
8627113 .. 8629236
2124 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG058400.1

Sequence Viewer

Length: 411 bp
ATGTCGTTGGGCTTCATCAACATTTCACCAATGGAATTGATTTATATAAAGAGCAAAGATGGGAAAATGCTAGTCACAAGTATTGTTGATTCTGGTCGTTATGCCAACAATATGCAATGTTCCAATGTATTGATCTATTCTGGTGAAGGTGGAAATTCTCCGTTTAATAGATTGAAACCAACAGATCAGACACTTGAGCGTGGAAACCTTGCATTGAAGAATAGCAAAGAAGCACAAACTCCTGTAAGGGTAATCCGCACCTTTAAACTTTCAAAGAGTTCATGTTATGTTTACTATGGTCTATACATCGTAGAGCATCTTTCAAAAGAAAGGGGGCAATTTGGTAAGATGGTTTATAAATTTAGGTTGAGAAGGAAGGCAGGACAACCAGAAATAACATTCAAACTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00310 ko04211 map00310 map04211
Pfam Domains
Protein Families
Pre-SET SAD_SRA SET

Protein Analysis

136

Amino Acids

15.5

Weight (kDa)

9.89

Isoelectric Point (pI)

32.59

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SAD_SRA PF02182 11 - 129 8.8e-32 SAD/SRA domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 357
AciI CCGC 1 cut(s) 256
AcsI RAATTY 2 cut(s) 154, 359
AgsI TTSAA 5 cut(s) 175, 217, 273, 324, 403
ApoI RAATTY 2 cut(s) 154, 359
AsuHPI GGTGA 2 cut(s) 18, 155
BccI CCATC 2 cut(s) 53, 343
BfaI CTAG 1 cut(s) 71
BmsI GCATC 1 cut(s) 325
BpuEI CTTGAG 1 cut(s) 215
Bse3DI GCAATG 1 cut(s) 122
BseMI GCAATG 1 cut(s) 122
Bsp143I GATC 2 cut(s) 132, 184
BspACI CCGC 1 cut(s) 256
BsrDI GCAATG 1 cut(s) 122
BssMI GATC 2 cut(s) 132, 184
Bst4CI ACNGT 1 cut(s) 408
BstKTI GATC 2 cut(s) 135, 187
BstMBI GATC 2 cut(s) 132, 184
CviAII CATG 1 cut(s) 282
CviJI RGCY 1 cut(s) 12
CviKI_1 RGCY 1 cut(s) 12
DpnI GATC 2 cut(s) 134, 186
DpnII GATC 2 cut(s) 132, 184
DraI TTTAAA 1 cut(s) 265
FaeI CATG 1 cut(s) 285
FaiI YATR 9 cut(s) 45, 47, 102, 113, 283, 288, 297, 304, 357
FatI CATG 1 cut(s) 281
FspBI CTAG 1 cut(s) 71
Hin1II CATG 1 cut(s) 285
HinfI GANTC 1 cut(s) 89
HphI GGTGA 2 cut(s) 18, 155
Hpy166II GTNNAC 1 cut(s) 292
Hpy188I TCNGA 1 cut(s) 189
Hpy8I GTNNAC 1 cut(s) 292
HpyAV CCTTC 3 cut(s) 140, 366, 370
HpyCH4III ACNGT 1 cut(s) 408
HpyCH4V TGCA 2 cut(s) 115, 212
Hsp92II CATG 1 cut(s) 285
Kzo9I GATC 2 cut(s) 132, 184
LpnPI CCDG 5 cut(s) 78, 126, 255, 366, 402
LweI GCATC 1 cut(s) 325
MaeI CTAG 1 cut(s) 71
MaeIII GTNAC 1 cut(s) 73
MalI GATC 2 cut(s) 134, 186
MboI GATC 2 cut(s) 132, 184
MboII GAAGA 1 cut(s) 229
MluCI AATT 4 cut(s) 35, 154, 338, 359
MseI TTAA 2 cut(s) 165, 264
NdeII GATC 2 cut(s) 132, 184
NlaIII CATG 1 cut(s) 285
NmuCI GTSAC 1 cut(s) 73
PfeI GAWTC 1 cut(s) 89
PsiI TTATAA 1 cut(s) 357
SaqAI TTAA 2 cut(s) 165, 264
Sau3AI GATC 2 cut(s) 132, 184
SetI ASST 4 cut(s) 151, 210, 263, 368
SfaNI GCATC 1 cut(s) 325
SmlI CTYRAG 1 cut(s) 194
SmoI CTYRAG 1 cut(s) 194
Sse9I AATT 4 cut(s) 35, 154, 338, 359
SsiI CCGC 1 cut(s) 256
SspMI CTAG 1 cut(s) 71
TaaI ACNGT 1 cut(s) 408
TasI AATT 4 cut(s) 35, 154, 338, 359
TfiI GAWTC 1 cut(s) 89
Tru1I TTAA 2 cut(s) 165, 264
Tru9I TTAA 2 cut(s) 165, 264
TseFI GTSAC 1 cut(s) 73
Tsp45I GTSAC 1 cut(s) 73
TspDTI ATGAA 2 cut(s) 4, 270
TspGWI ACGGA 1 cut(s) 150
XapI RAATTY 2 cut(s) 154, 359
XspI CTAG 1 cut(s) 71
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.