MD05G1040200.v1.1

50S ribosomal protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
OG0002385
Physical Location & Seq
Forward (+)
6857514 .. 6857822
309 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1040200.v1.1.491

Sequence Viewer

Length: 309 bp
ATGGGCCTCAATTGGTATGAACCAACAATCTCGGGTATTGGATCGACATCTTCTGACTCTAGGCCTGTTTCTACAGATTCCAAGGTTGCAGAGAAGATTGCATTTGATATAAAGATTGAGAAATTCGATGAAACGGCAAAGATCAAGATCATAAAGGAGGTTAGGACTTTCACTGACTTGGAACTGAAGGAGGCTAAAGAATTAGTGGAGAAAGTCCATGTTGTGGTGAAGAAAGGGTTAAAAAAGGAAGAAGCAGGGCCTATTGTCGACAAGCTAAAGGAATTGGGTGCTACTGTCGTATTGGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L12

Protein Analysis

103

Amino Acids

11.32

Weight (kDa)

5.93

Isoelectric Point (pI)

15.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L12 PF00542 35 - 101 6.4e-19 Ribosomal protein L7/L12 C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 223
AccI GTMKAC 1 cut(s) 267
AclWI GGATC 1 cut(s) 49
AcsI RAATTY 1 cut(s) 122
AcuI CTGAAG 1 cut(s) 206
AfiI CCNNNNNNNGG 1 cut(s) 223
AluBI AGCT 1 cut(s) 274
AluI AGCT 1 cut(s) 274
AlwI GGATC 1 cut(s) 49
Ama87I CYCGRG 1 cut(s) 31
AoxI GGCC 3 cut(s) 4, 62, 257
ApoI RAATTY 1 cut(s) 122
AspS9I GGNCC 2 cut(s) 4, 257
AsuHPI GGTGA 1 cut(s) 238
AvaI CYCGRG 1 cut(s) 31
BceAI ACGGC 1 cut(s) 150
BfaI CTAG 1 cut(s) 60
BfmI CTRYAG 1 cut(s) 72
BmeT110I CYCGRG 1 cut(s) 31
BmgT120I GGNCC 2 cut(s) 4, 257
BsaBI GATNNNNATC 2 cut(s) 46, 146
BsaJI CCNNGG 1 cut(s) 81
Bsc4I CCNNNNNNNGG 1 cut(s) 223
Bse8I GATNNNNATC 2 cut(s) 46, 146
BseDI CCNNGG 1 cut(s) 81
BseJI GATNNNNATC 2 cut(s) 46, 146
BseLI CCNNNNNNNGG 1 cut(s) 223
BshFI GGCC 3 cut(s) 6, 64, 259
BsiHKCI CYCGRG 1 cut(s) 31
BslI CCNNNNNNNGG 1 cut(s) 223
BsnI GGCC 3 cut(s) 6, 64, 259
BsoBI CYCGRG 1 cut(s) 31
Bsp143I GATC 3 cut(s) 41, 141, 147
BspANI GGCC 3 cut(s) 6, 64, 259
BspPI GGATC 1 cut(s) 49
BssECI CCNNGG 1 cut(s) 81
BssMI GATC 3 cut(s) 41, 141, 147
BssT1I CCWWGG 1 cut(s) 81
Bst4CI ACNGT 1 cut(s) 295
BstKTI GATC 3 cut(s) 44, 144, 150
BstMBI GATC 3 cut(s) 41, 141, 147
BstSFI CTRYAG 1 cut(s) 72
BsuRI GGCC 3 cut(s) 6, 64, 259
BtsIMutI CAGTG 1 cut(s) 171
Cfr13I GGNCC 2 cut(s) 4, 257
CviAII CATG 1 cut(s) 218
CviJI RGCY 5 cut(s) 6, 64, 194, 259, 274
CviKI_1 RGCY 5 cut(s) 6, 64, 194, 259, 274
DpnI GATC 3 cut(s) 43, 143, 149
DpnII GATC 3 cut(s) 41, 141, 147
Eco130I CCWWGG 1 cut(s) 81
Eco147I AGGCCT 1 cut(s) 64
Eco57I CTGAAG 1 cut(s) 206
Eco88I CYCGRG 1 cut(s) 31
EcoO109I RGGNCCY 1 cut(s) 257
EcoT14I CCWWGG 1 cut(s) 81
ErhI CCWWGG 1 cut(s) 81
FaeI CATG 1 cut(s) 221
FaiI YATR 4 cut(s) 18, 110, 152, 219
FatI CATG 1 cut(s) 217
FblI GTMKAC 1 cut(s) 267
FspBI CTAG 1 cut(s) 60
HaeIII GGCC 3 cut(s) 6, 64, 259
Hin1II CATG 1 cut(s) 221
HincII GTYRAC 1 cut(s) 268
HindII GTYRAC 1 cut(s) 268
HinfI GANTC 2 cut(s) 56, 77
HphI GGTGA 1 cut(s) 238
Hpy166II GTNNAC 1 cut(s) 268
Hpy188I TCNGA 1 cut(s) 55
Hpy188III TCNNGA 1 cut(s) 145
Hpy8I GTNNAC 1 cut(s) 268
HpyAV CCTTC 1 cut(s) 181
HpyCH4III ACNGT 1 cut(s) 295
HpyCH4V TGCA 2 cut(s) 89, 101
Hsp92II CATG 1 cut(s) 221
Kzo9I GATC 3 cut(s) 41, 141, 147
LpnPI CCDG 2 cut(s) 78, 240
MaeI CTAG 1 cut(s) 60
MalI GATC 3 cut(s) 43, 143, 149
MboI GATC 3 cut(s) 41, 141, 147
MboII GAAGA 4 cut(s) 42, 106, 241, 260
MfeI CAATTG 1 cut(s) 10
MluCI AATT 4 cut(s) 10, 122, 200, 281
MlyI GAGTC 1 cut(s) 50
MnlI CCTC 3 cut(s) 17, 151, 184
MseI TTAA 1 cut(s) 239
MunI CAATTG 1 cut(s) 10
NdeII GATC 3 cut(s) 41, 141, 147
NlaIII CATG 1 cut(s) 221
PceI AGGCCT 1 cut(s) 64
PfeI GAWTC 1 cut(s) 77
PflMI CCANNNNNTGG 1 cut(s) 223
PleI GAGTC 1 cut(s) 50
PpsI GAGTC 1 cut(s) 50
PspPI GGNCC 2 cut(s) 4, 257
SalI GTCGAC 1 cut(s) 266
SaqAI TTAA 1 cut(s) 239
Sau3AI GATC 3 cut(s) 41, 141, 147
Sau96I GGNCC 2 cut(s) 4, 257
SchI GAGTC 1 cut(s) 50
SetI ASST 3 cut(s) 87, 162, 276
SfcI CTRYAG 1 cut(s) 72
Sse9I AATT 4 cut(s) 10, 122, 200, 281
SseBI AGGCCT 1 cut(s) 64
SspMI CTAG 1 cut(s) 60
StuI AGGCCT 1 cut(s) 64
StyI CCWWGG 1 cut(s) 81
TaaI ACNGT 1 cut(s) 295
TaqI TCGA 3 cut(s) 44, 126, 267
TasI AATT 4 cut(s) 10, 122, 200, 281
TfiI GAWTC 1 cut(s) 77
Tru1I TTAA 1 cut(s) 239
Tru9I TTAA 1 cut(s) 239
TscAI CASTG 1 cut(s) 178
TspDTI ATGAA 2 cut(s) 33, 144
TspRI CASTG 1 cut(s) 178
Van91I CCANNNNNTGG 1 cut(s) 223
XapI RAATTY 1 cut(s) 122
XmiI GTMKAC 1 cut(s) 267
XspI CTAG 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.