MD05G1190300.v1.1

Retinoblastoma-related

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
Physical Location & Seq
Forward (+)
31939700 .. 31942008
2309 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1190300.v1.1.491

Sequence Viewer

Length: 270 bp
ATGGTGAAGATGGAAGATGCTAAGCCTGAAGTTTCAGCTTCCAACAATTCAAATTCCGAGAGCTGCGATTCTGGTCTTCTCCAAGATCGATTTACTTATTTGTGCAAGATGGTATTTGTCATTGGACGAGAACTCTTACAAGCAAGCTGCAAATATGTTCAAAGAAACCAAGATCTGTTAATATCAAATGCTTCAGCTATTGGCAATGGAACAGTATGTATTGTTATTTCTCCATTCTATAGTCATGTTAATAATGTTATGTTGAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

9.84

Weight (kDa)

6.53

Isoelectric Point (pI)

52.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 52
AcuI CTGAAG 2 cut(s) 48, 177
AgsI TTSAA 3 cut(s) 51, 161, 265
AluBI AGCT 4 cut(s) 38, 63, 147, 197
AluI AGCT 4 cut(s) 38, 63, 147, 197
ApeKI GCWGC 2 cut(s) 63, 147
ApoI RAATTY 1 cut(s) 52
AsuHPI GGTGA 1 cut(s) 16
BbsI GAAGAC 1 cut(s) 68
BbvI GCAGC 2 cut(s) 50, 134
BccI CCATC 2 cut(s) 4, 103
BfmI CTRYAG 1 cut(s) 238
BglII AGATCT 1 cut(s) 172
BisI GCNGC 2 cut(s) 64, 148
BlpI GCTNAGC 1 cut(s) 21
BlsI GCNGC 2 cut(s) 65, 149
BmsI GCATC 1 cut(s) 7
BpiI GAAGAC 1 cut(s) 68
Bpu1102I GCTNAGC 1 cut(s) 21
Bsa29I ATCGAT 1 cut(s) 88
Bse3DI GCAATG 1 cut(s) 211
BseCI ATCGAT 1 cut(s) 88
BseMI GCAATG 1 cut(s) 211
BseXI GCAGC 2 cut(s) 50, 134
BshVI ATCGAT 1 cut(s) 88
Bsp143I GATC 2 cut(s) 85, 172
Bsp1720I GCTNAGC 1 cut(s) 21
BspDI ATCGAT 1 cut(s) 88
BsrDI GCAATG 1 cut(s) 211
BssMI GATC 2 cut(s) 85, 172
Bst4CI ACNGT 1 cut(s) 214
BstC8I GCNNGC 1 cut(s) 145
BstDEI CTNAG 1 cut(s) 21
BstKTI GATC 2 cut(s) 88, 175
BstMBI GATC 2 cut(s) 85, 172
BstSFI CTRYAG 1 cut(s) 238
BstV1I GCAGC 2 cut(s) 50, 134
BstV2I GAAGAC 1 cut(s) 68
BstX2I RGATCY 1 cut(s) 172
BstYI RGATCY 1 cut(s) 172
Bsu15I ATCGAT 1 cut(s) 88
BsuTUI ATCGAT 1 cut(s) 88
Cac8I GCNNGC 1 cut(s) 145
ClaI ATCGAT 1 cut(s) 88
CviAII CATG 1 cut(s) 245
CviJI RGCY 5 cut(s) 25, 38, 63, 147, 197
CviKI_1 RGCY 5 cut(s) 25, 38, 63, 147, 197
DdeI CTNAG 1 cut(s) 21
DpnI GATC 2 cut(s) 87, 174
DpnII GATC 2 cut(s) 85, 172
Eco57I CTGAAG 2 cut(s) 48, 177
FaeI CATG 1 cut(s) 248
FaiI YATR 5 cut(s) 156, 217, 240, 246, 260
FatI CATG 1 cut(s) 244
Fnu4HI GCNGC 2 cut(s) 64, 148
Fsp4HI GCNGC 2 cut(s) 64, 148
GluI GCNGC 2 cut(s) 64, 148
Hin1II CATG 1 cut(s) 248
HinfI GANTC 1 cut(s) 68
HphI GGTGA 1 cut(s) 16
Hpy188I TCNGA 1 cut(s) 58
HpyCH4III ACNGT 1 cut(s) 214
HpyCH4V TGCA 2 cut(s) 105, 150
HpyF3I CTNAG 1 cut(s) 21
Hsp92II CATG 1 cut(s) 248
Kzo9I GATC 2 cut(s) 85, 172
LpnPI CCDG 2 cut(s) 39, 57
Lsp1109I GCAGC 2 cut(s) 50, 134
LweI GCATC 1 cut(s) 7
MalI GATC 2 cut(s) 87, 174
MboI GATC 2 cut(s) 85, 172
MboII GAAGA 3 cut(s) 19, 26, 68
MflI RGATCY 1 cut(s) 172
MluCI AATT 2 cut(s) 46, 52
MmeI TCCRAC 1 cut(s) 66
MseI TTAA 2 cut(s) 179, 249
NdeII GATC 2 cut(s) 85, 172
NlaIII CATG 1 cut(s) 248
PfeI GAWTC 1 cut(s) 68
PkrI GCNGC 2 cut(s) 65, 149
PsuI RGATCY 1 cut(s) 172
SaqAI TTAA 2 cut(s) 179, 249
SatI GCNGC 2 cut(s) 64, 148
Sau3AI GATC 2 cut(s) 85, 172
SetI ASST 4 cut(s) 40, 65, 149, 199
SfaNI GCATC 1 cut(s) 7
SfcI CTRYAG 1 cut(s) 238
Sse9I AATT 2 cut(s) 46, 52
TaaI ACNGT 1 cut(s) 214
TaqI TCGA 1 cut(s) 88
TasI AATT 2 cut(s) 46, 52
TfiI GAWTC 1 cut(s) 68
Tru1I TTAA 2 cut(s) 179, 249
Tru9I TTAA 2 cut(s) 179, 249
TseI GCWGC 2 cut(s) 63, 147
XapI RAATTY 1 cut(s) 52
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.