Rh7AG402200

Retinoblastoma-related

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Forward (+)
53051240 .. 53070425
19186 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG402200.1

Sequence Viewer

Length: 255 bp
ATGAGTAGATTCGTGTCATACCATCAGCATGAGCTGACGGAAGATTTCAGTGGATTGTTGTTGGACGAGAACCTGGTGGCACAAGCTATCAAGCTACTGATAGAAACGAAACATGTTCTAATATCAAATTTATCAGCTATCGGAAATGGAACGCCTGAAGAATTAGCAGAACAGTTCTGGTTTTCGTTTGTTTTGTTCTCGGTGAAAACATTGAGTGAGAAGAGTTCTGATAATTCACAAATTGAGAGCTGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.46

Weight (kDa)

4.65

Isoelectric Point (pI)

47.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 127
AcuI CTGAAG 1 cut(s) 177
AflIII ACRYGT 1 cut(s) 112
AjnI CCWGG 1 cut(s) 72
AluBI AGCT 5 cut(s) 34, 86, 94, 137, 249
AluI AGCT 5 cut(s) 34, 86, 94, 137, 249
ApeKI GCWGC 1 cut(s) 249
ApoI RAATTY 1 cut(s) 127
AsuHPI GGTGA 1 cut(s) 214
BbvI GCAGC 1 cut(s) 236
BccI CCATC 1 cut(s) 30
BciT130I CCWGG 1 cut(s) 74
BisI GCNGC 1 cut(s) 250
BlsI GCNGC 1 cut(s) 251
Bme1390I CCNGG 1 cut(s) 74
BmrFI CCNGG 1 cut(s) 74
BseBI CCWGG 1 cut(s) 74
BseXI GCAGC 1 cut(s) 236
Bst2UI CCWGG 1 cut(s) 74
Bst4CI ACNGT 1 cut(s) 174
Bst6I CTCTTC 1 cut(s) 215
BstNI CCWGG 1 cut(s) 74
BstNSI RCATGY 1 cut(s) 116
BstSCI CCNGG 1 cut(s) 72
BstV1I GCAGC 1 cut(s) 236
BtsIMutI CAGTG 1 cut(s) 55
CsiI ACCWGGT 1 cut(s) 72
CviAII CATG 2 cut(s) 29, 113
CviJI RGCY 5 cut(s) 34, 86, 94, 137, 249
CviKI_1 RGCY 5 cut(s) 34, 86, 94, 137, 249
Eam1104I CTCTTC 1 cut(s) 215
EarI CTCTTC 1 cut(s) 215
Eco57I CTGAAG 1 cut(s) 177
EcoRII CCWGG 1 cut(s) 72
FaeI CATG 2 cut(s) 32, 116
FaiI YATR 3 cut(s) 19, 30, 114
FatI CATG 2 cut(s) 28, 112
Fnu4HI GCNGC 1 cut(s) 250
Fsp4HI GCNGC 1 cut(s) 250
GluI GCNGC 1 cut(s) 250
Hin1II CATG 2 cut(s) 32, 116
HinfI GANTC 1 cut(s) 9
HphI GGTGA 1 cut(s) 214
Hpy188I TCNGA 2 cut(s) 143, 229
HpyCH4III ACNGT 1 cut(s) 174
Hsp92II CATG 2 cut(s) 32, 116
LpnPI CCDG 4 cut(s) 59, 86, 163, 168
Lsp1109I GCAGC 1 cut(s) 236
MabI ACCWGGT 1 cut(s) 72
MboII GAAGA 3 cut(s) 53, 170, 232
MluCI AATT 4 cut(s) 127, 161, 232, 240
MmeI TCCRAC 1 cut(s) 42
MslI CAYNNNNRTG 1 cut(s) 27
MspR9I CCNGG 1 cut(s) 74
MvaI CCWGG 1 cut(s) 74
NlaIII CATG 2 cut(s) 32, 116
NspI RCATGY 1 cut(s) 116
PciI ACATGT 1 cut(s) 112
PfeI GAWTC 1 cut(s) 9
PkrI GCNGC 1 cut(s) 251
PscI ACATGT 1 cut(s) 112
Psp6I CCWGG 1 cut(s) 72
PspGI CCWGG 1 cut(s) 72
RseI CAYNNNNRTG 1 cut(s) 27
SatI GCNGC 1 cut(s) 250
ScrFI CCNGG 1 cut(s) 74
SetI ASST 6 cut(s) 36, 75, 88, 96, 139, 251
SexAI ACCWGGT 1 cut(s) 72
SmiMI CAYNNNNRTG 1 cut(s) 27
Sse9I AATT 4 cut(s) 127, 161, 232, 240
StyD4I CCNGG 1 cut(s) 72
TaaI ACNGT 1 cut(s) 174
TasI AATT 4 cut(s) 127, 161, 232, 240
TfiI GAWTC 1 cut(s) 9
TscAI CASTG 1 cut(s) 55
TseI GCWGC 1 cut(s) 249
TspGWI ACGGA 1 cut(s) 53
TspRI CASTG 1 cut(s) 55
XapI RAATTY 1 cut(s) 127
XceI RCATGY 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.