Rroxscaffold_5G00364850

Retinoblastoma-related

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
46050105 .. 46066480
16376 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00364850.1

Sequence Viewer

Length: 849 bp
ATGGGTTCTGCCTCGGCGGCACAAGAAAATGCTCTTGCTTCCACCACGGATAGGTCTATTTCTATCACCTTGACCGACTTGGATGTGCTTGATTGTCCCATTTTCTATGAATCCTTGACCATCCCCGTCTTTCGGTTACATACATTGGTGGACCCTGTCACTTTAGTAATTGTCCATTTTGTTGGATGTATTCTATTCTCTAAAATCTTTAGTTGTTGGGACCCTGTGGTTGTGTCACATGATTCCGAGGGACATCACACGGATAGCAATTGTCCGGTGATCATCTCACAGATTTTGCCGGTCATCACACGGATAGCCATGATCCGGCGAATCATCACACAAATTTCGCCGGTCATCACACAAATAGAAATCATCACAAAGATTCATCACACCGATTTCAATGATTCATTATACGAGATATTCCTACACAAGCTTTGCATGGCAATCATCACAAAGATTCATCATACCGAGTTCAACGATTCGGTACACGATATTCCTACACAAGCTTTGCATGGCAATCATCACAAAGATTCATCATACCGAGAGCTTCCACAGTTTATTGTTAAGGCCGACCCAATTTTAAGTAATTTGTATGGCGTAGATTGGGAGAGCAAACTTGAGGGAAAAGAGTTGCAGTCAGGCCAATTTTCTGTAGACCCTACTTTTAAGCAAGGTGATATTGATTGGAAATTGAAGTTGAAAGTTGATATTGATTGGACACTAACTCTTAAGACGTTGCTGGAAACTCAAAAGTCCCCCAAGTCCCCGTCGAGGAGGGCAATCTTGGTTGGGGAGTTGTTCGACGGTTTGAAGCGTTTTCTTCCACTAGACTTGCAAGAGCATAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Pfam Domains
Protein Families

Protein Analysis

282

Amino Acids

31.92

Weight (kDa)

5.79

Isoelectric Point (pI)

43.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 654
AciI CCGC 1 cut(s) 17
AclWI GGATC 1 cut(s) 316
AcsI RAATTY 1 cut(s) 342
AfaI GTAC 1 cut(s) 486
AfiI CCNNNNNNNGG 4 cut(s) 51, 132, 324, 771
AflII CTTAAG 1 cut(s) 728
AgsI TTSAA 5 cut(s) 400, 475, 694, 700, 811
AluBI AGCT 3 cut(s) 433, 506, 547
AluI AGCT 3 cut(s) 433, 506, 547
AlwI GGATC 1 cut(s) 316
AoxI GGCC 2 cut(s) 567, 640
ApoI RAATTY 1 cut(s) 342
AspS9I GGNCC 2 cut(s) 151, 220
AsuHPI GGTGA 3 cut(s) 58, 289, 686
AvaII GGWCC 2 cut(s) 151, 220
BccI CCATC 1 cut(s) 128
BclI TGATCA 1 cut(s) 279
BfaI CTAG 1 cut(s) 827
BfmI CTRYAG 1 cut(s) 651
BfrI CTTAAG 1 cut(s) 728
BglI GCCNNNNNGGC 1 cut(s) 17
BisI GCNGC 1 cut(s) 18
BlsI GCNGC 1 cut(s) 19
Bme18I GGWCC 2 cut(s) 151, 220
BmgT120I GGNCC 2 cut(s) 151, 220
BmiI GGNNCC 3 cut(s) 153, 221, 222
BpuEI CTTGAG 1 cut(s) 638
BsaJI CCNNGG 3 cut(s) 12, 45, 246
BsaWI WCCGGW 1 cut(s) 274
Bsc4I CCNNNNNNNGG 4 cut(s) 51, 132, 324, 771
Bse118I RCCGGY 2 cut(s) 298, 349
BseDI CCNNGG 3 cut(s) 12, 45, 246
BseGI GGATG 3 cut(s) 88, 120, 191
BseLI CCNNNNNNNGG 4 cut(s) 51, 132, 324, 771
BseRI GAGGAG 1 cut(s) 787
BshFI GGCC 2 cut(s) 569, 642
BsiSI CCGG 4 cut(s) 275, 299, 325, 350
BslFI GGGAC 5 cut(s) 81, 233, 264, 739, 748
BslI CCNNNNNNNGG 4 cut(s) 51, 132, 324, 771
BsmFI GGGAC 5 cut(s) 81, 233, 264, 739, 748
BsnI GGCC 2 cut(s) 569, 642
Bsp143I GATC 2 cut(s) 279, 321
BspACI CCGC 1 cut(s) 17
BspANI GGCC 2 cut(s) 569, 642
BspLI GGNNCC 3 cut(s) 153, 221, 222
BspPI GGATC 1 cut(s) 316
BspTI CTTAAG 1 cut(s) 728
BsrFI RCCGGY 2 cut(s) 298, 349
BssAI RCCGGY 2 cut(s) 298, 349
BssECI CCNNGG 3 cut(s) 12, 45, 246
BssMI GATC 2 cut(s) 279, 321
Bst4CI ACNGT 2 cut(s) 555, 806
BstAFI CTTAAG 1 cut(s) 728
BstDSI CCRYGG 1 cut(s) 45
BstF5I GGATG 3 cut(s) 88, 120, 191
BstKTI GATC 2 cut(s) 282, 324
BstMBI GATC 2 cut(s) 279, 321
BstMWI GCNNNNNNNGC 1 cut(s) 17
BstSFI CTRYAG 1 cut(s) 651
BstXI CCANNNNNNTGG 1 cut(s) 182
BsuRI GGCC 2 cut(s) 569, 642
BtgI CCRYGG 1 cut(s) 45
BtsCI GGATG 3 cut(s) 88, 120, 191
Cfr10I RCCGGY 2 cut(s) 298, 349
Cfr13I GGNCC 2 cut(s) 151, 220
Csp6I GTAC 1 cut(s) 485
CspCI CAANNNNNGTGG 2 cut(s) 813, 848
CviAII CATG 4 cut(s) 239, 319, 439, 512
CviJI RGCY 6 cut(s) 317, 433, 506, 547, 569, 642
CviKI_1 RGCY 6 cut(s) 317, 433, 506, 547, 569, 642
CviQI GTAC 1 cut(s) 485
DpnI GATC 2 cut(s) 281, 323
DpnII GATC 2 cut(s) 279, 321
Eco47I GGWCC 2 cut(s) 151, 220
EcoO109I RGGNCCY 1 cut(s) 220
FaeI CATG 4 cut(s) 242, 322, 442, 515
FaqI GGGAC 5 cut(s) 81, 233, 264, 739, 748
FatI CATG 4 cut(s) 238, 318, 438, 511
FbaI TGATCA 1 cut(s) 279
FblI GTMKAC 1 cut(s) 654
Fnu4HI GCNGC 1 cut(s) 18
FokI GGATG 3 cut(s) 95, 107, 198
Fsp4HI GCNGC 1 cut(s) 18
FspBI CTAG 1 cut(s) 827
GluI GCNGC 1 cut(s) 18
HaeIII GGCC 2 cut(s) 569, 642
HapII CCGG 4 cut(s) 275, 299, 325, 350
Hin1II CATG 4 cut(s) 242, 322, 442, 515
HindIII AAGCTT 2 cut(s) 431, 504
HinfI GANTC 8 cut(s) 110, 242, 330, 382, 404, 457, 479, 530
HpaII CCGG 4 cut(s) 275, 299, 325, 350
HphI GGTGA 3 cut(s) 58, 289, 686
Hpy166II GTNNAC 3 cut(s) 151, 487, 655
Hpy188I TCNGA 1 cut(s) 247
Hpy8I GTNNAC 3 cut(s) 151, 487, 655
Hpy99I CGWCG 2 cut(s) 772, 806
HpyCH4III ACNGT 2 cut(s) 555, 806
HpyCH4IV ACGT 1 cut(s) 734
HpyCH4V TGCA 4 cut(s) 438, 511, 634, 835
HpyF10VI GCNNNNNNNGC 1 cut(s) 17
HpySE526I ACGT 1 cut(s) 734
Hsp92II CATG 4 cut(s) 242, 322, 442, 515
KflI GGGWCCC 1 cut(s) 220
Ksp22I TGATCA 1 cut(s) 279
Kzo9I GATC 2 cut(s) 279, 321
LpnPI CCDG 8 cut(s) 168, 237, 288, 312, 338, 363, 624, 725
MaeI CTAG 1 cut(s) 827
MaeII ACGT 1 cut(s) 734
MaeIII GTNAC 3 cut(s) 135, 157, 234
MalI GATC 2 cut(s) 281, 323
MboI GATC 2 cut(s) 279, 321
MboII GAAGA 1 cut(s) 812
MfeI CAATTG 1 cut(s) 268
MluCI AATT 8 cut(s) 168, 268, 342, 576, 586, 644, 689, 844
MmeI TCCRAC 1 cut(s) 163
MnlI CCTC 5 cut(s) 22, 241, 613, 765, 768
MseI TTAA 4 cut(s) 564, 581, 666, 729
MspCI CTTAAG 1 cut(s) 728
MspI CCGG 4 cut(s) 275, 299, 325, 350
MunI CAATTG 1 cut(s) 268
MwoI GCNNNNNNNGC 1 cut(s) 17
NdeII GATC 2 cut(s) 279, 321
NlaIII CATG 4 cut(s) 242, 322, 442, 515
NlaIV GGNNCC 3 cut(s) 153, 221, 222
NmuCI GTSAC 2 cut(s) 157, 234
PfeI GAWTC 8 cut(s) 110, 242, 330, 382, 404, 457, 479, 530
PflFI GACNNNGTC 1 cut(s) 155
PkrI GCNGC 1 cut(s) 19
PpuMI RGGWCCY 1 cut(s) 220
Psp5II RGGWCCY 1 cut(s) 220
PspN4I GGNNCC 3 cut(s) 153, 221, 222
PspPI GGNCC 2 cut(s) 151, 220
PspPPI RGGWCCY 1 cut(s) 220
PsyI GACNNNGTC 1 cut(s) 155
RsaI GTAC 1 cut(s) 486
RsaNI GTAC 1 cut(s) 485
SaqAI TTAA 4 cut(s) 564, 581, 666, 729
SatI GCNGC 1 cut(s) 18
Sau3AI GATC 2 cut(s) 279, 321
Sau96I GGNCC 2 cut(s) 151, 220
SetI ASST 7 cut(s) 56, 71, 435, 508, 549, 676, 737
SfcI CTRYAG 1 cut(s) 651
SinI GGWCC 2 cut(s) 151, 220
SmlI CTYRAG 2 cut(s) 617, 728
SmoI CTYRAG 2 cut(s) 617, 728
Sse9I AATT 8 cut(s) 168, 268, 342, 576, 586, 644, 689, 844
SsiI CCGC 1 cut(s) 17
SspMI CTAG 1 cut(s) 827
TaaI ACNGT 2 cut(s) 555, 806
TaiI ACGT 1 cut(s) 737
TaqI TCGA 2 cut(s) 770, 801
TaqII GACCGA 1 cut(s) 89
TasI AATT 8 cut(s) 168, 268, 342, 576, 586, 644, 689, 844
TauI GCSGC 1 cut(s) 20
TfiI GAWTC 8 cut(s) 110, 242, 330, 382, 404, 457, 479, 530
Tru1I TTAA 4 cut(s) 564, 581, 666, 729
Tru9I TTAA 4 cut(s) 564, 581, 666, 729
TseFI GTSAC 2 cut(s) 157, 234
Tsp45I GTSAC 2 cut(s) 157, 234
TspDTI ATGAA 5 cut(s) 123, 374, 396, 449, 522
TspGWI ACGGA 3 cut(s) 62, 275, 325
Tth111I GACNNNGTC 1 cut(s) 155
Vha464I CTTAAG 1 cut(s) 728
VpaK11BI GGWCC 2 cut(s) 151, 220
XapI RAATTY 1 cut(s) 342
XmiI GTMKAC 1 cut(s) 654
XspI CTAG 1 cut(s) 827
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.