Rh2DG483400

Retinoblastoma-related

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Reverse (-)
69906428 .. 69909920
3493 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG483400.1

Sequence Viewer

Length: 207 bp
ATGAATTCAACCAACGGGCTGACGGAAGATTTCAGTGGATTGTTGTTGGACGAGAACCTGGTGGCACAAGCTATCAAGCTACTGATAGAAACGAAACATGTTCTAATATCAAATTTATCAGCTATCGGAAATGGAACGATTGGGAGAGCAAACCTGAGCAATATATTGGGATCAATTGACATTGTTCAATCGGTAATTGAATCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.15

Weight (kDa)

4.43

Isoelectric Point (pI)

33.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 178
AcsI RAATTY 2 cut(s) 4, 112
AflIII ACRYGT 1 cut(s) 97
AgsI TTSAA 3 cut(s) 9, 188, 200
AjnI CCWGG 1 cut(s) 57
AluBI AGCT 3 cut(s) 71, 79, 122
AluI AGCT 3 cut(s) 71, 79, 122
AlwI GGATC 1 cut(s) 178
ApoI RAATTY 2 cut(s) 4, 112
BciT130I CCWGG 1 cut(s) 59
Bme1390I CCNGG 1 cut(s) 59
BmrFI CCNGG 1 cut(s) 59
Bpu10I CCTNAGC 1 cut(s) 155
BseBI CCWGG 1 cut(s) 59
BseMII CTCAG 1 cut(s) 146
Bsp143I GATC 1 cut(s) 170
BspCNI CTCAG 1 cut(s) 147
BspPI GGATC 1 cut(s) 178
BssMI GATC 1 cut(s) 170
Bst2UI CCWGG 1 cut(s) 59
BstDEI CTNAG 1 cut(s) 155
BstKTI GATC 1 cut(s) 173
BstMBI GATC 1 cut(s) 170
BstNI CCWGG 1 cut(s) 59
BstNSI RCATGY 1 cut(s) 101
BstSCI CCNGG 1 cut(s) 57
BtsIMutI CAGTG 1 cut(s) 40
CsiI ACCWGGT 1 cut(s) 57
CviAII CATG 1 cut(s) 98
CviJI RGCY 4 cut(s) 19, 71, 79, 122
CviKI_1 RGCY 4 cut(s) 19, 71, 79, 122
DdeI CTNAG 1 cut(s) 155
DpnI GATC 1 cut(s) 172
DpnII GATC 1 cut(s) 170
EcoRI GAATTC 1 cut(s) 4
EcoRII CCWGG 1 cut(s) 57
FaeI CATG 1 cut(s) 101
FaiI YATR 2 cut(s) 99, 164
FatI CATG 1 cut(s) 97
Hin1II CATG 1 cut(s) 101
HinfI GANTC 1 cut(s) 200
Hpy188I TCNGA 1 cut(s) 128
Hpy188III TCNNGA 1 cut(s) 204
HpyF3I CTNAG 1 cut(s) 155
Hsp92II CATG 1 cut(s) 101
Kzo9I GATC 1 cut(s) 170
LpnPI CCDG 3 cut(s) 44, 71, 167
MabI ACCWGGT 1 cut(s) 57
MalI GATC 1 cut(s) 172
MboI GATC 1 cut(s) 170
MboII GAAGA 1 cut(s) 38
MfeI CAATTG 1 cut(s) 174
MluCI AATT 4 cut(s) 4, 112, 174, 195
MmeI TCCRAC 1 cut(s) 27
MspR9I CCNGG 1 cut(s) 59
MunI CAATTG 1 cut(s) 174
MvaI CCWGG 1 cut(s) 59
NdeII GATC 1 cut(s) 170
NlaIII CATG 1 cut(s) 101
NspI RCATGY 1 cut(s) 101
PciI ACATGT 1 cut(s) 97
PfeI GAWTC 1 cut(s) 200
PscI ACATGT 1 cut(s) 97
Psp6I CCWGG 1 cut(s) 57
PspGI CCWGG 1 cut(s) 57
Sau3AI GATC 1 cut(s) 170
ScrFI CCNGG 1 cut(s) 59
SetI ASST 5 cut(s) 60, 73, 81, 124, 156
SexAI ACCWGGT 1 cut(s) 57
SgeI CNNG 8 cut(s) 28, 64, 70, 71, 80, 88, 110, 166
Sse9I AATT 4 cut(s) 4, 112, 174, 195
StyD4I CCNGG 1 cut(s) 57
TasI AATT 4 cut(s) 4, 112, 174, 195
TfiI GAWTC 1 cut(s) 200
TscAI CASTG 1 cut(s) 40
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 38
TspRI CASTG 1 cut(s) 40
XapI RAATTY 2 cut(s) 4, 112
XceI RCATGY 1 cut(s) 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.