Rroxscaffold_6G00412130

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
34741880 .. 34742876
997 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00412130.1

Sequence Viewer

Length: 258 bp
ATGAAAGATGCATCTCCCTTTCTAGAATCTCTTTCCTTTGTACGATTTATCTTAAGGTGCAAAGGTAGAGATACAATGTACAATATTACCTCTTTAGATGGATCAAAACCTTCTTATGAATACCCATCTATAGATTTTCTTAGTGCCTTACAATGCATCTGGGGTAGGAGAGCTAACCATGTTTATAGTCAAGTGGAAATTGATGAAGTCCGTAATGAGCTCGCAAGTTATGTGTTGAAGAACATCCTCAAGTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

85

Amino Acids

9.85

Weight (kDa)

7.76

Isoelectric Point (pI)

49.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 109
AfaI GTAC 2 cut(s) 42, 80
AflII CTTAAG 1 cut(s) 52
AgsI TTSAA 1 cut(s) 238
AluBI AGCT 2 cut(s) 173, 220
AluI AGCT 2 cut(s) 173, 220
Alw21I GWGCWC 1 cut(s) 222
AlwI GGATC 1 cut(s) 109
BanII GRGCYC 1 cut(s) 222
Bbv12I GWGCWC 1 cut(s) 222
BccI CCATC 2 cut(s) 92, 133
BfaI CTAG 1 cut(s) 23
BfmI CTRYAG 1 cut(s) 129
BfrI CTTAAG 1 cut(s) 52
BmsI GCATC 2 cut(s) 20, 165
BpuEI CTTGAG 1 cut(s) 233
BseGI GGATG 1 cut(s) 243
BsiHKAI GWGCWC 1 cut(s) 222
Bsp1286I GDGCHC 1 cut(s) 222
Bsp1407I TGTACA 1 cut(s) 78
Bsp143I GATC 1 cut(s) 101
BspPI GGATC 1 cut(s) 109
BspTI CTTAAG 1 cut(s) 52
BsrGI TGTACA 1 cut(s) 78
BssMI GATC 1 cut(s) 101
BstAFI CTTAAG 1 cut(s) 52
BstAUI TGTACA 1 cut(s) 78
BstC8I GCNNGC 1 cut(s) 222
BstDEI CTNAG 1 cut(s) 140
BstF5I GGATG 1 cut(s) 243
BstKTI GATC 1 cut(s) 104
BstMBI GATC 1 cut(s) 101
BstSFI CTRYAG 1 cut(s) 129
BtsCI GGATG 1 cut(s) 243
Cac8I GCNNGC 1 cut(s) 222
Csp6I GTAC 2 cut(s) 41, 79
CviAII CATG 1 cut(s) 179
CviJI RGCY 2 cut(s) 173, 220
CviKI_1 RGCY 2 cut(s) 173, 220
CviQI GTAC 2 cut(s) 41, 79
DdeI CTNAG 1 cut(s) 140
DpnI GATC 1 cut(s) 103
DpnII GATC 1 cut(s) 101
Ecl136II GAGCTC 1 cut(s) 220
Eco24I GRGCYC 1 cut(s) 222
Eco53kI GAGCTC 1 cut(s) 220
EcoICRI GAGCTC 1 cut(s) 220
EcoT22I ATGCAT 2 cut(s) 13, 158
EcoT38I GRGCYC 1 cut(s) 222
FaeI CATG 1 cut(s) 182
FaiI YATR 5 cut(s) 117, 131, 180, 186, 231
FatI CATG 1 cut(s) 178
FokI GGATG 1 cut(s) 230
FriOI GRGCYC 1 cut(s) 222
FspBI CTAG 1 cut(s) 23
Hin1II CATG 1 cut(s) 182
HinfI GANTC 1 cut(s) 26
Hpy188III TCNNGA 1 cut(s) 23
HpyAV CCTTC 1 cut(s) 120
HpyCH4V TGCA 3 cut(s) 11, 60, 156
HpyF3I CTNAG 1 cut(s) 140
Hsp92II CATG 1 cut(s) 182
Kzo9I GATC 1 cut(s) 101
LpnPI CCDG 1 cut(s) 145
LweI GCATC 2 cut(s) 20, 165
MaeI CTAG 1 cut(s) 23
MalI GATC 1 cut(s) 103
MboI GATC 1 cut(s) 101
MboII GAAGA 1 cut(s) 250
MhlI GDGCHC 1 cut(s) 222
MluCI AATT 1 cut(s) 198
MnlI CCTC 2 cut(s) 100, 257
Mph1103I ATGCAT 2 cut(s) 13, 158
MseI TTAA 1 cut(s) 53
MspCI CTTAAG 1 cut(s) 52
NdeII GATC 1 cut(s) 101
NlaIII CATG 1 cut(s) 182
NsiI ATGCAT 2 cut(s) 13, 158
PfeI GAWTC 1 cut(s) 26
Psp124BI GAGCTC 1 cut(s) 222
RsaI GTAC 2 cut(s) 42, 80
RsaNI GTAC 2 cut(s) 41, 79
SacI GAGCTC 1 cut(s) 222
SaqAI TTAA 1 cut(s) 53
Sau3AI GATC 1 cut(s) 101
SduI GDGCHC 1 cut(s) 222
SetI ASST 6 cut(s) 59, 67, 92, 112, 175, 222
SfaNI GCATC 2 cut(s) 20, 165
SfcI CTRYAG 1 cut(s) 129
SgeI CNNG 6 cut(s) 35, 172, 191, 203, 233, 237
SmlI CTYRAG 2 cut(s) 52, 248
SmoI CTYRAG 2 cut(s) 52, 248
Sse9I AATT 1 cut(s) 198
SspI AATATT 1 cut(s) 85
SspMI CTAG 1 cut(s) 23
SstI GAGCTC 1 cut(s) 222
TasI AATT 1 cut(s) 198
TatI WGTACW 1 cut(s) 78
TfiI GAWTC 1 cut(s) 26
Tru1I TTAA 1 cut(s) 53
Tru9I TTAA 1 cut(s) 53
TspDTI ATGAA 3 cut(s) 17, 132, 219
TspGWI ACGGA 1 cut(s) 200
Vha464I CTTAAG 1 cut(s) 52
XbaI TCTAGA 1 cut(s) 22
XspI CTAG 1 cut(s) 23
Zsp2I ATGCAT 2 cut(s) 13, 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.