Rh6BG199800

NADH kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Forward (+)
37643725 .. 37644295
571 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG199800.1

Sequence Viewer

Length: 189 bp
ATGATTCAGCGGCTTATCATTGGTATTGTGATCAACTTTGGGCCATCACATAGAGAGAATAATGGGGATGATGAGAGGATAGAGAACTTGGCCAGGAGGTCAAATGACCAATCTGAACAATGTTGTGGGAGTAATGGGATATGCTCTTATGAAGTTCTTTGGGATGGTGGACTTGCTATAGGCATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

6.85

Weight (kDa)

4.6

Isoelectric Point (pI)

40.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 10
AcoI YGGCCR 1 cut(s) 90
AjnI CCWGG 1 cut(s) 92
AoxI GGCC 2 cut(s) 41, 90
AspS9I GGNCC 1 cut(s) 41
BalI TGGCCA 1 cut(s) 92
BccI CCATC 2 cut(s) 52, 158
BciT130I CCWGG 1 cut(s) 94
BclI TGATCA 1 cut(s) 30
BfmI CTRYAG 1 cut(s) 177
BisI GCNGC 1 cut(s) 11
BlsI GCNGC 1 cut(s) 12
Bme1390I CCNGG 1 cut(s) 94
BmgT120I GGNCC 1 cut(s) 41
BmrFI CCNGG 1 cut(s) 94
BseBI CCWGG 1 cut(s) 94
BseGI GGATG 2 cut(s) 73, 169
BshFI GGCC 2 cut(s) 43, 92
BsnI GGCC 2 cut(s) 43, 92
Bsp143I GATC 1 cut(s) 30
BspACI CCGC 1 cut(s) 10
BspANI GGCC 2 cut(s) 43, 92
BssMI GATC 1 cut(s) 30
Bst2UI CCWGG 1 cut(s) 94
BstF5I GGATG 2 cut(s) 73, 169
BstKTI GATC 1 cut(s) 33
BstMBI GATC 1 cut(s) 30
BstNI CCWGG 1 cut(s) 94
BstSCI CCNGG 1 cut(s) 92
BstSFI CTRYAG 1 cut(s) 177
BsuRI GGCC 2 cut(s) 43, 92
BtsCI GGATG 2 cut(s) 73, 169
Cfr13I GGNCC 1 cut(s) 41
CviJI RGCY 3 cut(s) 13, 43, 92
CviKI_1 RGCY 3 cut(s) 13, 43, 92
DpnI GATC 1 cut(s) 32
DpnII GATC 1 cut(s) 30
EaeI YGGCCR 1 cut(s) 90
EcoRII CCWGG 1 cut(s) 92
FaiI YATR 4 cut(s) 51, 142, 150, 179
FbaI TGATCA 1 cut(s) 30
Fnu4HI GCNGC 1 cut(s) 11
FokI GGATG 2 cut(s) 80, 176
Fsp4HI GCNGC 1 cut(s) 11
GluI GCNGC 1 cut(s) 11
HaeIII GGCC 2 cut(s) 43, 92
HinfI GANTC 1 cut(s) 4
Hpy166II GTNNAC 1 cut(s) 170
Hpy188I TCNGA 2 cut(s) 115, 188
Hpy8I GTNNAC 1 cut(s) 170
Ksp22I TGATCA 1 cut(s) 30
Kzo9I GATC 1 cut(s) 30
LpnPI CCDG 2 cut(s) 79, 106
MalI GATC 1 cut(s) 32
MboI GATC 1 cut(s) 30
MlsI TGGCCA 1 cut(s) 92
MluNI TGGCCA 1 cut(s) 92
MnlI CCTC 2 cut(s) 69, 90
Mox20I TGGCCA 1 cut(s) 92
MscI TGGCCA 1 cut(s) 92
Msp20I TGGCCA 1 cut(s) 92
MspA1I CMGCKG 1 cut(s) 10
MspR9I CCNGG 1 cut(s) 94
MvaI CCWGG 1 cut(s) 94
NdeII GATC 1 cut(s) 30
PfeI GAWTC 1 cut(s) 4
PkrI GCNGC 1 cut(s) 12
Psp6I CCWGG 1 cut(s) 92
PspGI CCWGG 1 cut(s) 92
PspPI GGNCC 1 cut(s) 41
SatI GCNGC 1 cut(s) 11
Sau3AI GATC 1 cut(s) 30
Sau96I GGNCC 1 cut(s) 41
ScrFI CCNGG 1 cut(s) 94
SetI ASST 1 cut(s) 101
SfcI CTRYAG 1 cut(s) 177
SgeI CNNG 4 cut(s) 100, 105, 106, 185
SsiI CCGC 1 cut(s) 10
StyD4I CCNGG 1 cut(s) 92
TauI GCSGC 1 cut(s) 13
TfiI GAWTC 1 cut(s) 4
TspDTI ATGAA 1 cut(s) 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.