Rh7BG407300

LRR receptor-like serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
OG0003465
Physical Location & Seq
Forward (+)
45616621 .. 45618948
2328 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG407300.1

Sequence Viewer

Length: 507 bp
ATGGAATTCTTTTCAGGTACATCATGGAGGTTCTGGGACAGCTGCTGCTGGTTTGAAAGCTGCGGTAACATAATTGCTTATGCTATTCTTTGCAATCTGACATTTTTGAATGAAAGCTGCGGTAACGTAACTGCTTGTGCTATTCTTTGCAATCTGACATTTTTGAATGATTCAACGGCATATCTTTGGGCATCACATAGAGAGAATAATGGGGATGATGAGAGGATAGAGAACTTGGCCAGGAGGTCAAATGACCAATCTGAACAATGTTGTGGGAGTATGAGATATGCTCTTATGAAGTTCTTTGGGATGGTGAATGTGATACTGATTCAAAATCGCTTCTCAATAAGTTTGCAAGAAAGGGTCGGAGAAAACGAAAACTTATGTGCAGCAATATCATGCAAGAAGAAGAAAGCCAATGTCTTCGTTCCATTAATTGGAGTAGTTGGTGGACTTGCTATAGGCATCTCACAAGGGTCTGATCTAATCACTGCCCTTTACTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_4 LRR_8 Malectin_like Pkinase Pkinase_Tyr

Protein Analysis

168

Amino Acids

18.69

Weight (kDa)

5.15

Isoelectric Point (pI)

50.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 437
AciI CCGC 2 cut(s) 63, 120
AcoI YGGCCR 1 cut(s) 237
AcsI RAATTY 1 cut(s) 5
AfaI GTAC 1 cut(s) 19
AfiI CCNNNNNNNGG 1 cut(s) 437
AgsI TTSAA 5 cut(s) 56, 109, 166, 174, 332
AjnI CCWGG 1 cut(s) 239
AluBI AGCT 3 cut(s) 42, 60, 117
AluI AGCT 3 cut(s) 42, 60, 117
AlwNI CAGNNNCTG 1 cut(s) 45
AoxI GGCC 1 cut(s) 237
ApeKI GCWGC 5 cut(s) 42, 45, 60, 117, 389
ApoI RAATTY 1 cut(s) 5
AseI ATTAAT 1 cut(s) 434
AsuHPI GGTGA 1 cut(s) 325
BalI TGGCCA 1 cut(s) 239
BbsI GAAGAC 1 cut(s) 415
BbvI GCAGC 5 cut(s) 29, 32, 47, 104, 401
BccI CCATC 1 cut(s) 304
BceAI ACGGC 1 cut(s) 192
BciT130I CCWGG 1 cut(s) 241
BfmI CTRYAG 1 cut(s) 459
BisI GCNGC 5 cut(s) 43, 46, 61, 118, 390
BlsI GCNGC 5 cut(s) 44, 47, 62, 119, 391
Bme1390I CCNGG 1 cut(s) 241
BmrFI CCNGG 1 cut(s) 241
BmsI GCATC 2 cut(s) 200, 474
BpiI GAAGAC 1 cut(s) 415
BplI GAGNNNNNCTC 2 cut(s) 274, 306
Bsc4I CCNNNNNNNGG 1 cut(s) 437
BseBI CCWGG 1 cut(s) 241
BseGI GGATG 2 cut(s) 220, 315
BseLI CCNNNNNNNGG 1 cut(s) 437
BseXI GCAGC 5 cut(s) 29, 32, 47, 104, 401
BsgI GTGCAG 1 cut(s) 408
BshFI GGCC 1 cut(s) 239
BslFI GGGAC 1 cut(s) 50
BslI CCNNNNNNNGG 1 cut(s) 437
BsmFI GGGAC 1 cut(s) 50
BsnI GGCC 1 cut(s) 239
Bsp143I GATC 1 cut(s) 481
BspACI CCGC 2 cut(s) 63, 120
BspANI GGCC 1 cut(s) 239
BssMI GATC 1 cut(s) 481
Bst2UI CCWGG 1 cut(s) 241
BstF5I GGATG 2 cut(s) 220, 315
BstKTI GATC 1 cut(s) 484
BstMBI GATC 1 cut(s) 481
BstNI CCWGG 1 cut(s) 241
BstSCI CCNGG 1 cut(s) 239
BstSFI CTRYAG 1 cut(s) 459
BstV1I GCAGC 5 cut(s) 29, 32, 47, 104, 401
BstV2I GAAGAC 1 cut(s) 415
BsuRI GGCC 1 cut(s) 239
BtsCI GGATG 2 cut(s) 220, 315
BtsI GCAGTG 1 cut(s) 489
BtsIMutI CAGTG 1 cut(s) 489
CaiI CAGNNNCTG 1 cut(s) 45
Csp6I GTAC 1 cut(s) 18
CviAII CATG 2 cut(s) 24, 399
CviJI RGCY 5 cut(s) 42, 60, 117, 239, 416
CviKI_1 RGCY 5 cut(s) 42, 60, 117, 239, 416
CviQI GTAC 1 cut(s) 18
DpnI GATC 1 cut(s) 483
DpnII GATC 1 cut(s) 481
EaeI YGGCCR 1 cut(s) 237
EcoRI GAATTC 1 cut(s) 5
EcoRII CCWGG 1 cut(s) 239
FaeI CATG 2 cut(s) 27, 402
FaqI GGGAC 1 cut(s) 50
FatI CATG 2 cut(s) 23, 398
Fnu4HI GCNGC 5 cut(s) 43, 46, 61, 118, 390
FokI GGATG 2 cut(s) 227, 322
Fsp4HI GCNGC 5 cut(s) 43, 46, 61, 118, 390
GluI GCNGC 5 cut(s) 43, 46, 61, 118, 390
HaeIII GGCC 1 cut(s) 239
Hin1II CATG 2 cut(s) 27, 402
HinfI GANTC 2 cut(s) 170, 328
HphI GGTGA 1 cut(s) 325
Hpy166II GTNNAC 1 cut(s) 452
Hpy188I TCNGA 5 cut(s) 99, 156, 262, 368, 481
Hpy188III TCNNGA 1 cut(s) 504
Hpy8I GTNNAC 1 cut(s) 452
HpyCH4IV ACGT 1 cut(s) 126
HpyCH4V TGCA 5 cut(s) 93, 150, 355, 389, 402
HpySE526I ACGT 1 cut(s) 126
Hsp92II CATG 2 cut(s) 27, 402
Kzo9I GATC 1 cut(s) 481
LpnPI CCDG 4 cut(s) 19, 34, 226, 253
Lsp1109I GCAGC 5 cut(s) 29, 32, 47, 104, 401
LweI GCATC 2 cut(s) 200, 474
MaeII ACGT 1 cut(s) 126
MaeIII GTNAC 3 cut(s) 65, 122, 127
MalI GATC 1 cut(s) 483
MboI GATC 1 cut(s) 481
MboII GAAGA 3 cut(s) 415, 418, 421
MlsI TGGCCA 1 cut(s) 239
MluCI AATT 3 cut(s) 5, 72, 435
MluNI TGGCCA 1 cut(s) 239
MmeI TCCRAC 1 cut(s) 346
MnlI CCTC 3 cut(s) 21, 216, 237
Mox20I TGGCCA 1 cut(s) 239
MscI TGGCCA 1 cut(s) 239
MseI TTAA 1 cut(s) 434
Msp20I TGGCCA 1 cut(s) 239
MspA1I CMGCKG 1 cut(s) 42
MspR9I CCNGG 1 cut(s) 241
MvaI CCWGG 1 cut(s) 241
NdeII GATC 1 cut(s) 481
NlaIII CATG 2 cut(s) 27, 402
PcsI WCGNNNNNNNCGW 1 cut(s) 372
PfeI GAWTC 2 cut(s) 170, 328
PflMI CCANNNNNTGG 1 cut(s) 437
PkrI GCNGC 5 cut(s) 44, 47, 62, 119, 391
PshBI ATTAAT 1 cut(s) 434
Psp6I CCWGG 1 cut(s) 239
PspGI CCWGG 1 cut(s) 239
PstNI CAGNNNCTG 1 cut(s) 45
PvuII CAGCTG 1 cut(s) 42
RsaI GTAC 1 cut(s) 19
RsaNI GTAC 1 cut(s) 18
SaqAI TTAA 1 cut(s) 434
SatI GCNGC 5 cut(s) 43, 46, 61, 118, 390
Sau3AI GATC 1 cut(s) 481
ScrFI CCNGG 1 cut(s) 241
SetI ASST 7 cut(s) 19, 32, 44, 62, 119, 129, 248
SfaNI GCATC 2 cut(s) 200, 474
SfcI CTRYAG 1 cut(s) 459
Sse9I AATT 3 cut(s) 5, 72, 435
SsiI CCGC 2 cut(s) 63, 120
StyD4I CCNGG 1 cut(s) 239
TaiI ACGT 1 cut(s) 129
TasI AATT 3 cut(s) 5, 72, 435
TfiI GAWTC 2 cut(s) 170, 328
Tru1I TTAA 1 cut(s) 434
Tru9I TTAA 1 cut(s) 434
TscAI CASTG 1 cut(s) 496
TseI GCWGC 5 cut(s) 42, 45, 60, 117, 389
TspDTI ATGAA 2 cut(s) 126, 311
TspRI CASTG 1 cut(s) 496
Van91I CCANNNNNTGG 1 cut(s) 437
VspI ATTAAT 1 cut(s) 434
XapI RAATTY 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.