Rroxscaffold_3G00238930

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
27331136 .. 27335294
4159 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00238930.1

Sequence Viewer

Length: 219 bp
ATGGATTTGGATGCCACTTTGGTATCGTCGAGAAAAGTCTGGTTGGTTTGGTGGCTTTGTTTGAGCCATAAAAGGTGCGAAGGGAGGAGAAGAAGCCGATGTCGTCGGTTTGAGTTTTTGTGGGGTAGGAGAGCTAACCATGTTTATAGTCAAGTGGAAATTGATGAAGTGCGTAATGAGCTCGCAAGTTATGTGCTCAAGAACATCCTCAAGTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.79

Weight (kDa)

10.04

Isoelectric Point (pI)

80.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 2 cut(s) 134, 181
AluI AGCT 2 cut(s) 134, 181
Alw21I GWGCWC 2 cut(s) 183, 198
BaeI ACNNNNGTAYC 1 cut(s) 39
BanII GRGCYC 1 cut(s) 183
Bbv12I GWGCWC 2 cut(s) 183, 198
BpuEI CTTGAG 2 cut(s) 182, 194
BseGI GGATG 2 cut(s) 16, 204
BseRI GAGGAG 1 cut(s) 100
BsiHKAI GWGCWC 2 cut(s) 183, 198
Bsp1286I GDGCHC 2 cut(s) 183, 198
BstC8I GCNNGC 1 cut(s) 183
BstF5I GGATG 2 cut(s) 16, 204
BstMWI GCNNNNNNNGC 1 cut(s) 178
BtsCI GGATG 2 cut(s) 16, 204
Cac8I GCNNGC 1 cut(s) 183
CviAII CATG 1 cut(s) 140
CviJI RGCY 5 cut(s) 55, 66, 96, 134, 181
CviKI_1 RGCY 5 cut(s) 55, 66, 96, 134, 181
Ecl136II GAGCTC 1 cut(s) 181
Eco24I GRGCYC 1 cut(s) 183
Eco53kI GAGCTC 1 cut(s) 181
EcoICRI GAGCTC 1 cut(s) 181
EcoT38I GRGCYC 1 cut(s) 183
FaeI CATG 1 cut(s) 143
FaiI YATR 4 cut(s) 69, 141, 147, 192
FatI CATG 1 cut(s) 139
FokI GGATG 2 cut(s) 23, 191
FriOI GRGCYC 1 cut(s) 183
Hin1II CATG 1 cut(s) 143
Hpy188III TCNNGA 2 cut(s) 30, 199
Hpy99I CGWCG 2 cut(s) 31, 108
HpyAV CCTTC 1 cut(s) 74
HpyF10VI GCNNNNNNNGC 1 cut(s) 178
Hsp92II CATG 1 cut(s) 143
LpnPI CCDG 1 cut(s) 25
MboII GAAGA 1 cut(s) 102
MhlI GDGCHC 2 cut(s) 183, 198
MluCI AATT 1 cut(s) 159
MnlI CCTC 2 cut(s) 78, 218
MwoI GCNNNNNNNGC 1 cut(s) 178
NlaIII CATG 1 cut(s) 143
Psp124BI GAGCTC 1 cut(s) 183
SacI GAGCTC 1 cut(s) 183
SduI GDGCHC 2 cut(s) 183, 198
SetI ASST 3 cut(s) 77, 136, 183
SgeI CNNG 7 cut(s) 42, 52, 152, 164, 194, 198, 211
SmlI CTYRAG 2 cut(s) 197, 209
SmoI CTYRAG 2 cut(s) 197, 209
Sse9I AATT 1 cut(s) 159
SstI GAGCTC 1 cut(s) 183
TaqI TCGA 1 cut(s) 29
TasI AATT 1 cut(s) 159
TspDTI ATGAA 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.