MD05G1234800.v1.1

Knottins

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
Physical Location & Seq
Reverse (-)
36691937 .. 36692268
332 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1234800.v1.1.491

Sequence Viewer

Length: 222 bp
ATGATCATCCTTATAACTTCTCGAGAGATGGTGATGCACAGTGAAGCAAAGATTTGTTCAGAGCCAAGTAAAACATTCAAAGGGATATGCATCATACAGAGGAACTGCATGGTGAGACGCCACAGCGAGGGGTATGGTTACGGCAAATGCTCACATGTCCTACGCCGGTGCATGTTCTATAAACCTTGTGACCTGGATCAAACTACTCATGAAATTTCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.5

Weight (kDa)

8.85

Isoelectric Point (pI)

65.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Gamma-thionin PF00304 17 - 63 1.6e-10 Gamma-thionin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 14
AclWI GGATC 1 cut(s) 204
AcsI RAATTY 1 cut(s) 213
AcyI GRCGYC 1 cut(s) 118
AfiI CCNNNNNNNGG 1 cut(s) 127
AflIII ACRYGT 1 cut(s) 154
AgsI TTSAA 1 cut(s) 79
AjnI CCWGG 1 cut(s) 192
Alw26I GTCTC 1 cut(s) 109
AlwI GGATC 1 cut(s) 204
Ama87I CYCGRG 1 cut(s) 21
ApoI RAATTY 1 cut(s) 213
AsuHPI GGTGA 2 cut(s) 43, 124
AvaI CYCGRG 1 cut(s) 21
BccI CCATC 1 cut(s) 22
BceAI ACGGC 1 cut(s) 157
BciT130I CCWGG 1 cut(s) 194
BclI TGATCA 1 cut(s) 3
BcoDI GTCTC 1 cut(s) 109
Bme1390I CCNGG 1 cut(s) 194
BmeT110I CYCGRG 1 cut(s) 21
BmrFI CCNGG 1 cut(s) 194
BmsI GCATC 2 cut(s) 24, 99
BsaBI GATNNNNATC 1 cut(s) 89
BsaHI GRCGYC 1 cut(s) 118
Bsc4I CCNNNNNNNGG 1 cut(s) 127
Bse118I RCCGGY 1 cut(s) 165
Bse8I GATNNNNATC 1 cut(s) 89
BseBI CCWGG 1 cut(s) 194
BseGI GGATG 1 cut(s) 6
BseJI GATNNNNATC 1 cut(s) 89
BseLI CCNNNNNNNGG 1 cut(s) 127
BsiHKCI CYCGRG 1 cut(s) 21
BsiSI CCGG 1 cut(s) 166
BslI CCNNNNNNNGG 1 cut(s) 127
BsmAI GTCTC 1 cut(s) 109
BsmBI CGTCTC 1 cut(s) 109
BsoBI CYCGRG 1 cut(s) 21
Bsp143I GATC 2 cut(s) 3, 196
BspHI TCATGA 2 cut(s) 208, 218
BspPI GGATC 1 cut(s) 204
BsrFI RCCGGY 1 cut(s) 165
BssAI RCCGGY 1 cut(s) 165
BssMI GATC 2 cut(s) 3, 196
BssNI GRCGYC 1 cut(s) 118
Bst2UI CCWGG 1 cut(s) 194
Bst4CI ACNGT 1 cut(s) 41
BstACI GRCGYC 1 cut(s) 118
BstF5I GGATG 1 cut(s) 6
BstKTI GATC 2 cut(s) 6, 199
BstMAI GTCTC 1 cut(s) 109
BstMBI GATC 2 cut(s) 3, 196
BstNI CCWGG 1 cut(s) 194
BstNSI RCATGY 2 cut(s) 158, 175
BstSCI CCNGG 1 cut(s) 192
BtsCI GGATG 1 cut(s) 6
BtsIMutI CAGTG 1 cut(s) 46
CciI TCATGA 2 cut(s) 208, 218
Cfr10I RCCGGY 1 cut(s) 165
CseI GACGC 1 cut(s) 126
CviAII CATG 5 cut(s) 109, 155, 172, 209, 219
CviJI RGCY 1 cut(s) 64
CviKI_1 RGCY 1 cut(s) 64
DpnI GATC 2 cut(s) 5, 198
DpnII GATC 2 cut(s) 3, 196
Eco88I CYCGRG 1 cut(s) 21
EcoRII CCWGG 1 cut(s) 192
EcoT22I ATGCAT 1 cut(s) 92
Esp3I CGTCTC 1 cut(s) 109
FaeI CATG 5 cut(s) 112, 158, 175, 212, 222
FatI CATG 5 cut(s) 108, 154, 171, 208, 218
FbaI TGATCA 1 cut(s) 3
HapII CCGG 1 cut(s) 166
HgaI GACGC 1 cut(s) 126
Hin1I GRCGYC 1 cut(s) 118
Hin1II CATG 5 cut(s) 112, 158, 175, 212, 222
HpaII CCGG 1 cut(s) 166
HphI GGTGA 2 cut(s) 43, 124
Hpy188I TCNGA 1 cut(s) 61
Hpy188III TCNNGA 4 cut(s) 21, 23, 209, 219
HpyCH4III ACNGT 1 cut(s) 41
HpyCH4V TGCA 4 cut(s) 37, 90, 108, 171
Hsp92I GRCGYC 1 cut(s) 118
Hsp92II CATG 5 cut(s) 112, 158, 175, 212, 222
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 2 cut(s) 3, 196
LpnPI CCDG 3 cut(s) 179, 179, 206
LweI GCATC 2 cut(s) 24, 99
MaeIII GTNAC 2 cut(s) 137, 188
MalI GATC 2 cut(s) 5, 198
MboI GATC 2 cut(s) 3, 196
MluCI AATT 1 cut(s) 213
MnlI CCTC 2 cut(s) 93, 121
Mph1103I ATGCAT 1 cut(s) 92
MspI CCGG 1 cut(s) 166
MspR9I CCNGG 1 cut(s) 194
MvaI CCWGG 1 cut(s) 194
NdeII GATC 2 cut(s) 3, 196
NlaIII CATG 5 cut(s) 112, 158, 175, 212, 222
NmuCI GTSAC 1 cut(s) 188
NsiI ATGCAT 1 cut(s) 92
NspI RCATGY 2 cut(s) 158, 175
PaeR7I CTCGAG 1 cut(s) 21
PagI TCATGA 2 cut(s) 208, 218
PciI ACATGT 1 cut(s) 154
PscI ACATGT 1 cut(s) 154
PsiI TTATAA 1 cut(s) 14
Psp6I CCWGG 1 cut(s) 192
PspGI CCWGG 1 cut(s) 192
Sau3AI GATC 2 cut(s) 3, 196
ScrFI CCNGG 1 cut(s) 194
SetI ASST 2 cut(s) 187, 195
SfaNI GCATC 2 cut(s) 24, 99
Sfr274I CTCGAG 1 cut(s) 21
SgrAI CRCCGGYG 1 cut(s) 165
SlaI CTCGAG 1 cut(s) 21
SmlI CTYRAG 1 cut(s) 21
SmoI CTYRAG 1 cut(s) 21
Sse9I AATT 1 cut(s) 213
StyD4I CCNGG 1 cut(s) 192
TaaI ACNGT 1 cut(s) 41
TaqI TCGA 1 cut(s) 22
TasI AATT 1 cut(s) 213
TscAI CASTG 1 cut(s) 46
TseFI GTSAC 1 cut(s) 188
Tsp45I GTSAC 1 cut(s) 188
TspDTI ATGAA 1 cut(s) 207
TspRI CASTG 1 cut(s) 46
XapI RAATTY 1 cut(s) 213
XceI RCATGY 2 cut(s) 158, 175
XhoI CTCGAG 1 cut(s) 21
Zsp2I ATGCAT 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.