Rw5G015290

Belongs to the DEFL family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
OG0001621
Physical Location & Seq
Reverse (-)
19000959 .. 19001255
297 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G015290.1

Sequence Viewer

Length: 297 bp
ATGCAGGTGCAAGTTGGAGCTGATGAATGTGAGTATCGAAGCGCACATTTCAGGGGGCCCTGCTTTGGACGCAATCACGAGTGCTACATCTGTTGCCAGGAGGAAGGTTTTGATCGGGGCTCATGCAAAGGGTTTCACAACCGTCATTGTATCTGCACTAAGCCTTGTAGATCACCTGGAGGTCCTCCTACCTACGAACCTCCTCCTCCTCCTCCTCCTTCTCCAGAAGAAGATGTTCCTCCTCCTCCCGAAGAAGATGTTCCTCCTACTCCTAAAGAAGAAGCTCCCATTAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0006950 GO:0006952 GO:0008150 GO:0050896
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Gamma-thionin

Protein Analysis

98

Amino Acids

10.86

Weight (kDa)

4.95

Isoelectric Point (pI)

90.03

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Gamma-thionin PF00304 10 - 56 2.8e-09 Gamma-thionin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 65
AjnI CCWGG 2 cut(s) 96, 175
AluBI AGCT 2 cut(s) 20, 284
AluI AGCT 2 cut(s) 20, 284
AoxI GGCC 1 cut(s) 56
ApaI GGGCCC 1 cut(s) 60
AseI ATTAAT 1 cut(s) 291
Asp700I GAANNNNTTC 2 cut(s) 234, 258
AspLEI GCGC 1 cut(s) 44
AspS9I GGNCC 3 cut(s) 56, 57, 182
AsuHPI GGTGA 1 cut(s) 165
AvaII GGWCC 1 cut(s) 182
BaeGI GKGCMC 1 cut(s) 60
BanII GRGCYC 2 cut(s) 60, 122
BauI CACGAG 1 cut(s) 77
BciT130I CCWGG 2 cut(s) 98, 177
Bme1390I CCNGG 2 cut(s) 98, 177
Bme18I GGWCC 1 cut(s) 182
BmgT120I GGNCC 3 cut(s) 56, 57, 182
BmiI GGNNCC 2 cut(s) 57, 58
BmrFI CCNGG 2 cut(s) 98, 177
BpmI CTGGAG 2 cut(s) 198, 207
Bsc4I CCNNNNNNNGG 1 cut(s) 65
BseBI CCWGG 2 cut(s) 98, 177
BseLI CCNNNNNNNGG 1 cut(s) 65
BseRI GAGGAG 7 cut(s) 192, 195, 198, 201, 204, 231, 234
BseSI GKGCMC 1 cut(s) 60
BsgI GTGCAG 1 cut(s) 139
BshFI GGCC 1 cut(s) 58
BslI CCNNNNNNNGG 1 cut(s) 65
BsnI GGCC 1 cut(s) 58
Bsp120I GGGCCC 1 cut(s) 56
Bsp1286I GDGCHC 2 cut(s) 60, 122
Bsp143I GATC 2 cut(s) 112, 170
BspANI GGCC 1 cut(s) 58
BspLI GGNNCC 2 cut(s) 57, 58
BssMI GATC 2 cut(s) 112, 170
BssSI CACGAG 1 cut(s) 77
Bst2BI CACGAG 1 cut(s) 77
Bst2UI CCWGG 2 cut(s) 98, 177
Bst4CI ACNGT 1 cut(s) 143
BstDEI CTNAG 1 cut(s) 159
BstHHI GCGC 1 cut(s) 44
BstKTI GATC 2 cut(s) 115, 173
BstMBI GATC 2 cut(s) 112, 170
BstMWI GCNNNNNNNGC 1 cut(s) 69
BstNI CCWGG 2 cut(s) 98, 177
BstSCI CCNGG 2 cut(s) 96, 175
BstSLI GKGCMC 1 cut(s) 60
BsuRI GGCC 1 cut(s) 58
CfoI GCGC 1 cut(s) 44
Cfr13I GGNCC 3 cut(s) 56, 57, 182
CseI GACGC 1 cut(s) 78
CviAII CATG 1 cut(s) 123
CviJI RGCY 5 cut(s) 20, 58, 120, 163, 284
CviKI_1 RGCY 5 cut(s) 20, 58, 120, 163, 284
DdeI CTNAG 1 cut(s) 159
DpnI GATC 2 cut(s) 114, 172
DpnII GATC 2 cut(s) 112, 170
Eco24I GRGCYC 2 cut(s) 60, 122
Eco47I GGWCC 1 cut(s) 182
EcoO109I RGGNCCY 3 cut(s) 56, 57, 182
EcoRII CCWGG 2 cut(s) 96, 175
EcoT38I GRGCYC 2 cut(s) 60, 122
FaeI CATG 1 cut(s) 126
FaiI YATR 1 cut(s) 124
FatI CATG 1 cut(s) 122
FriOI GRGCYC 2 cut(s) 60, 122
GlaI GCGC 1 cut(s) 43
GsuI CTGGAG 2 cut(s) 198, 207
HaeIII GGCC 1 cut(s) 58
HgaI GACGC 1 cut(s) 78
HhaI GCGC 1 cut(s) 44
Hin1II CATG 1 cut(s) 126
Hin6I GCGC 1 cut(s) 42
HinP1I GCGC 1 cut(s) 42
HphI GGTGA 1 cut(s) 165
Hpy188III TCNNGA 3 cut(s) 77, 224, 248
HpyAV CCTTC 2 cut(s) 98, 228
HpyCH4III ACNGT 1 cut(s) 143
HpyCH4V TGCA 4 cut(s) 4, 10, 126, 156
HpyF10VI GCNNNNNNNGC 1 cut(s) 69
HpyF3I CTNAG 1 cut(s) 159
Hsp92II CATG 1 cut(s) 126
HspAI GCGC 1 cut(s) 42
Kzo9I GATC 2 cut(s) 112, 170
LmnI GCTCC 2 cut(s) 17, 289
LpnPI CCDG 7 cut(s) 37, 73, 83, 110, 162, 189, 237
MalI GATC 2 cut(s) 114, 172
MboI GATC 2 cut(s) 112, 170
MboII GAAGA 5 cut(s) 239, 242, 263, 266, 290
MhlI GDGCHC 2 cut(s) 60, 122
MluCI AATT 1 cut(s) 292
MroXI GAANNNNTTC 2 cut(s) 234, 258
MseI TTAA 1 cut(s) 291
MspR9I CCNGG 2 cut(s) 98, 177
MvaI CCWGG 2 cut(s) 98, 177
MwoI GCNNNNNNNGC 1 cut(s) 69
NdeII GATC 2 cut(s) 112, 170
NlaIII CATG 1 cut(s) 126
NlaIV GGNNCC 2 cut(s) 57, 58
PdmI GAANNNNTTC 2 cut(s) 234, 258
PpuMI RGGWCCY 1 cut(s) 182
PshBI ATTAAT 1 cut(s) 291
Psp5II RGGWCCY 1 cut(s) 182
Psp6I CCWGG 2 cut(s) 96, 175
PspGI CCWGG 2 cut(s) 96, 175
PspN4I GGNNCC 2 cut(s) 57, 58
PspOMI GGGCCC 1 cut(s) 56
PspPI GGNCC 3 cut(s) 56, 57, 182
PspPPI RGGWCCY 1 cut(s) 182
SaqAI TTAA 1 cut(s) 291
Sau3AI GATC 2 cut(s) 112, 170
Sau96I GGNCC 3 cut(s) 56, 57, 182
ScrFI CCNGG 2 cut(s) 98, 177
SduI GDGCHC 2 cut(s) 60, 122
SetI ASST 8 cut(s) 9, 22, 109, 178, 184, 194, 202, 286
SinI GGWCC 1 cut(s) 182
Sse9I AATT 1 cut(s) 292
StyD4I CCNGG 2 cut(s) 96, 175
TaaI ACNGT 1 cut(s) 143
TaqI TCGA 1 cut(s) 37
TasI AATT 1 cut(s) 292
Tru1I TTAA 1 cut(s) 291
Tru9I TTAA 1 cut(s) 291
TspDTI ATGAA 1 cut(s) 39
VpaK11BI GGWCC 1 cut(s) 182
VspI ATTAAT 1 cut(s) 291
XmnI GAANNNNTTC 2 cut(s) 234, 258
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.