Rmu_sc0035288.1_g000001

Belongs to the DEFL family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0035288.1
OG0001621
Physical Location & Seq
Forward (+)
1 .. 391
391 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0035288.1_g000001.1.cds

Sequence Viewer

Length: 294 bp
aacaatcacatctctcactatcttttctctgttttcaaacttcacaacttgattaagcaatcatggtcatggggaggaagtgtctgggtcttctctttgtgctcttcattgtcttggctttcacaagacgtggtggtgccaagtgaggctagggtttgcgagtcaaggagtcatggattccatgggacatgtattcaccacaacaactgtgctctcgtctgccgtaacgtaggcttccccagtggtagatgccatggattccatcgccgctgcttttgcactcgaaattgttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Gamma-thionin

Protein Analysis

97

Amino Acids

11.08

Weight (kDa)

9.04

Isoelectric Point (pI)

63.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 136
AciI CCGC 1 cut(s) 268
AflIII ACRYGT 1 cut(s) 188
AgsI TTSAA 1 cut(s) 37
AjiI CACGTC 1 cut(s) 130
Alw21I GWGCWC 2 cut(s) 104, 214
ApeKI GCWGC 1 cut(s) 270
AsuHPI GGTGA 1 cut(s) 188
BanI GGYRCC 1 cut(s) 136
BbsI GAAGAC 1 cut(s) 82
Bbv12I GWGCWC 2 cut(s) 104, 214
BbvI GCAGC 1 cut(s) 257
BccI CCATC 1 cut(s) 270
BceAI ACGGC 1 cut(s) 207
BfaI CTAG 1 cut(s) 150
BisI GCNGC 2 cut(s) 268, 271
BlsI GCNGC 2 cut(s) 269, 272
BmgBI CACGTC 1 cut(s) 130
BmiI GGNNCC 1 cut(s) 138
BmrI ACTGGG 1 cut(s) 234
BmsI GCATC 1 cut(s) 239
BmuI ACTGGG 1 cut(s) 234
BpiI GAAGAC 1 cut(s) 82
BsaJI CCNNGG 2 cut(s) 181, 253
BsaXI ACNNNNNCTCC 2 cut(s) 66, 96
Bse1I ACTGG 1 cut(s) 240
BseDI CCNNGG 2 cut(s) 181, 253
BseNI ACTGG 1 cut(s) 240
BseXI GCAGC 1 cut(s) 257
BshNI GGYRCC 1 cut(s) 136
BsiHKAI GWGCWC 2 cut(s) 104, 214
BslFI GGGAC 1 cut(s) 199
BsmFI GGGAC 1 cut(s) 199
Bsp1286I GDGCHC 2 cut(s) 104, 214
Bsp19I CCATGG 2 cut(s) 181, 253
BspACI CCGC 1 cut(s) 268
BspLI GGNNCC 1 cut(s) 138
BspQI GCTCTTC 1 cut(s) 109
BspT107I GGYRCC 1 cut(s) 136
BsrI ACTGG 1 cut(s) 240
BssECI CCNNGG 2 cut(s) 181, 253
BssT1I CCWWGG 2 cut(s) 181, 253
Bst4CI ACNGT 1 cut(s) 209
Bst6I CTCTTC 1 cut(s) 109
BstDSI CCRYGG 2 cut(s) 181, 253
BstMWI GCNNNNNNNGC 1 cut(s) 276
BstNSI RCATGY 1 cut(s) 192
BstV1I GCAGC 1 cut(s) 257
BstV2I GAAGAC 1 cut(s) 82
BtgI CCRYGG 2 cut(s) 181, 253
BtgZI GCGATG 1 cut(s) 248
BtrI CACGTC 1 cut(s) 130
BtsIMutI CAGTG 1 cut(s) 247
CviAII CATG 6 cut(s) 63, 69, 173, 182, 189, 254
CviJI RGCY 3 cut(s) 118, 149, 234
CviKI_1 RGCY 3 cut(s) 118, 149, 234
Eam1104I CTCTTC 1 cut(s) 109
EarI CTCTTC 1 cut(s) 109
Eco130I CCWWGG 2 cut(s) 181, 253
EcoT14I CCWWGG 2 cut(s) 181, 253
ErhI CCWWGG 2 cut(s) 181, 253
FaeI CATG 6 cut(s) 66, 72, 176, 185, 192, 257
FaiI YATR 6 cut(s) 64, 70, 174, 183, 190, 255
FaqI GGGAC 1 cut(s) 199
FatI CATG 6 cut(s) 62, 68, 172, 181, 188, 253
Fnu4HI GCNGC 2 cut(s) 268, 271
Fsp4HI GCNGC 2 cut(s) 268, 271
FspBI CTAG 1 cut(s) 150
GluI GCNGC 2 cut(s) 268, 271
Hin1II CATG 6 cut(s) 66, 72, 176, 185, 192, 257
HinfI GANTC 4 cut(s) 161, 169, 177, 258
HphI GGTGA 1 cut(s) 188
HpyCH4III ACNGT 1 cut(s) 209
HpyCH4IV ACGT 2 cut(s) 129, 228
HpyCH4V TGCA 1 cut(s) 279
HpyF10VI GCNNNNNNNGC 1 cut(s) 276
HpySE526I ACGT 2 cut(s) 129, 228
Hsp92II CATG 6 cut(s) 66, 72, 176, 185, 192, 257
LguI GCTCTTC 1 cut(s) 109
LpnPI CCDG 2 cut(s) 70, 253
Lsp1109I GCAGC 1 cut(s) 257
LweI GCATC 1 cut(s) 239
MaeI CTAG 1 cut(s) 150
MaeII ACGT 2 cut(s) 129, 228
MaeIII GTNAC 1 cut(s) 224
MboII GAAGA 2 cut(s) 82, 96
MhlI GDGCHC 2 cut(s) 104, 214
MluCI AATT 1 cut(s) 286
MlyI GAGTC 2 cut(s) 170, 178
MnlI CCTC 2 cut(s) 68, 139
MseI TTAA 1 cut(s) 54
MslI CAYNNNNRTG 1 cut(s) 67
MspA1I CMGCKG 1 cut(s) 270
MwoI GCNNNNNNNGC 1 cut(s) 276
NcoI CCATGG 2 cut(s) 181, 253
NlaIII CATG 6 cut(s) 66, 72, 176, 185, 192, 257
NlaIV GGNNCC 1 cut(s) 138
NspI RCATGY 1 cut(s) 192
PciI ACATGT 1 cut(s) 188
PciSI GCTCTTC 1 cut(s) 109
PfeI GAWTC 2 cut(s) 177, 258
PkrI GCNGC 2 cut(s) 269, 272
PleI GAGTC 2 cut(s) 169, 177
PpsI GAGTC 2 cut(s) 169, 177
PscI ACATGT 1 cut(s) 188
PspN4I GGNNCC 1 cut(s) 138
RseI CAYNNNNRTG 1 cut(s) 67
SapI GCTCTTC 1 cut(s) 109
SaqAI TTAA 1 cut(s) 54
SatI GCNGC 2 cut(s) 268, 271
SchI GAGTC 2 cut(s) 170, 178
SduI GDGCHC 2 cut(s) 104, 214
SetI ASST 2 cut(s) 132, 231
SfaNI GCATC 1 cut(s) 239
SmiMI CAYNNNNRTG 1 cut(s) 67
Sse9I AATT 1 cut(s) 286
SsiI CCGC 1 cut(s) 268
SspMI CTAG 1 cut(s) 150
StyI CCWWGG 2 cut(s) 181, 253
TaaI ACNGT 1 cut(s) 209
TaiI ACGT 2 cut(s) 132, 231
TaqI TCGA 1 cut(s) 283
TasI AATT 1 cut(s) 286
TauI GCSGC 1 cut(s) 270
TfiI GAWTC 2 cut(s) 177, 258
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TscAI CASTG 1 cut(s) 247
TseI GCWGC 1 cut(s) 270
TspDTI ATGAA 1 cut(s) 96
TspRI CASTG 1 cut(s) 247
XceI RCATGY 1 cut(s) 192
XspI CTAG 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.