Rh5AG172100

Knottins

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0001621
Physical Location & Seq
Forward (+)
19027707 .. 19028398
692 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG172100.1

Sequence Viewer

Length: 210 bp
ATGGACAGGAAGTTCTTAGGGCTTGTTTTGTTCTTCGTCATCCTCCTGACTTCTCAAGAGACGGTGATGCAGAGTGAAGCAAAGATCTGCGAGTACCCAAGCAGAACATTCAAAGGGCTGTGCGTCAAGGACAAAAACTGTGTCGTGAGATGTCGGAGTGAGGGTTACAATTACGGCAAATGCTCCCATGTCCGCCGACTATATGGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Gamma-thionin

Protein Analysis

69

Amino Acids

8.02

Weight (kDa)

9.3

Isoelectric Point (pI)

38.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Gamma-thionin PF00304 28 - 66 9e-11 Gamma-thionin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 193
AfaI GTAC 1 cut(s) 95
AgsI TTSAA 1 cut(s) 112
AloI GAACNNNNNNTCC 1 cut(s) 28
Alw26I GTCTC 1 cut(s) 53
ArsI GACNNNNNNTTYG 2 cut(s) 126, 158
AsuHPI GGTGA 1 cut(s) 76
BceAI ACGGC 1 cut(s) 190
BcoDI GTCTC 1 cut(s) 53
BglII AGATCT 1 cut(s) 84
BmsI GCATC 1 cut(s) 57
BpuEI CTTGAG 1 cut(s) 39
BsaXI ACNNNNNCTCC 2 cut(s) 148, 178
BseGI GGATG 1 cut(s) 39
BsmAI GTCTC 1 cut(s) 53
BsmBI CGTCTC 1 cut(s) 53
Bsp143I GATC 1 cut(s) 84
BspACI CCGC 1 cut(s) 193
BssMI GATC 1 cut(s) 84
Bst4CI ACNGT 2 cut(s) 64, 140
BstDEI CTNAG 1 cut(s) 16
BstF5I GGATG 1 cut(s) 39
BstKTI GATC 1 cut(s) 87
BstMAI GTCTC 1 cut(s) 53
BstMBI GATC 1 cut(s) 84
BstX2I RGATCY 1 cut(s) 84
BstYI RGATCY 1 cut(s) 84
BtsCI GGATG 1 cut(s) 39
CseI GACGC 1 cut(s) 112
Csp6I GTAC 1 cut(s) 94
CviAII CATG 1 cut(s) 188
CviJI RGCY 2 cut(s) 22, 118
CviKI_1 RGCY 2 cut(s) 22, 118
CviQI GTAC 1 cut(s) 94
DdeI CTNAG 1 cut(s) 16
DpnI GATC 1 cut(s) 86
DpnII GATC 1 cut(s) 84
EciI GGCGGA 1 cut(s) 182
Esp3I CGTCTC 1 cut(s) 53
FaeI CATG 1 cut(s) 191
FaiI YATR 3 cut(s) 189, 202, 204
FatI CATG 1 cut(s) 187
FokI GGATG 1 cut(s) 26
HgaI GACGC 1 cut(s) 112
Hin1II CATG 1 cut(s) 191
HphI GGTGA 1 cut(s) 76
Hpy188I TCNGA 1 cut(s) 156
Hpy188III TCNNGA 3 cut(s) 46, 56, 145
HpyCH4III ACNGT 2 cut(s) 64, 140
HpyCH4V TGCA 1 cut(s) 70
HpyF3I CTNAG 1 cut(s) 16
Hsp92II CATG 1 cut(s) 191
Kzo9I GATC 1 cut(s) 84
LmnI GCTCC 1 cut(s) 188
LpnPI CCDG 1 cut(s) 59
LweI GCATC 1 cut(s) 57
MaeIII GTNAC 1 cut(s) 164
MalI GATC 1 cut(s) 86
MboI GATC 1 cut(s) 84
MboII GAAGA 1 cut(s) 25
MflI RGATCY 1 cut(s) 84
MluCI AATT 1 cut(s) 169
MmeI TCCRAC 1 cut(s) 134
MnlI CCTC 2 cut(s) 53, 154
NdeII GATC 1 cut(s) 84
NlaIII CATG 1 cut(s) 191
PsuI RGATCY 1 cut(s) 84
RsaI GTAC 1 cut(s) 95
RsaNI GTAC 1 cut(s) 94
Sau3AI GATC 1 cut(s) 84
SfaNI GCATC 1 cut(s) 57
SgeI CNNG 9 cut(s) 19, 35, 58, 68, 103, 111, 139, 157, 200
SmlI CTYRAG 1 cut(s) 54
SmoI CTYRAG 1 cut(s) 54
Sse9I AATT 1 cut(s) 169
SsiI CCGC 1 cut(s) 193
TaaI ACNGT 2 cut(s) 64, 140
TasI AATT 1 cut(s) 169
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.