Rroxscaffold_1G00055160

Knottins

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
76651425 .. 76651583
159 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00055160.1

Sequence Viewer

Length: 159 bp
ATGCAAAGTGAAGCAATGATTTGCAAAGTCCCTAGCAAAACTTTCAAAGGGCTGTGCTTCAGTCACAAGAACTGTATTGTGAGATGTCACAGTGAGGGTTACGGTTGGGGCAAATGCTCTCATATCCGACGACGGTGCATGTGCTACAAGCCTTGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

52

Amino Acids

6.03

Weight (kDa)

9.35

Isoelectric Point (pI)

65.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Gamma-thionin PF00304 7 - 52 1.2e-14 Gamma-thionin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 43
AgsI TTSAA 1 cut(s) 46
BcgI CGANNNNNNTGC 2 cut(s) 117, 151
BfaI CTAG 1 cut(s) 33
Bse3DI GCAATG 1 cut(s) 21
BseMI GCAATG 1 cut(s) 21
BslFI GGGAC 1 cut(s) 14
BsmFI GGGAC 1 cut(s) 14
BsrDI GCAATG 1 cut(s) 21
Bst4CI ACNGT 4 cut(s) 74, 92, 104, 135
BstNSI RCATGY 1 cut(s) 142
BtsIMutI CAGTG 1 cut(s) 97
CviAII CATG 1 cut(s) 139
CviJI RGCY 2 cut(s) 52, 151
CviKI_1 RGCY 2 cut(s) 52, 151
Eco57I CTGAAG 1 cut(s) 43
FaeI CATG 1 cut(s) 142
FaiI YATR 2 cut(s) 123, 140
FaqI GGGAC 1 cut(s) 14
FatI CATG 1 cut(s) 138
FspBI CTAG 1 cut(s) 33
Hin1II CATG 1 cut(s) 142
Hpy188I TCNGA 1 cut(s) 128
Hpy99I CGWCG 2 cut(s) 132, 135
HpyCH4III ACNGT 4 cut(s) 74, 92, 104, 135
HpyCH4V TGCA 3 cut(s) 4, 24, 138
Hsp92II CATG 1 cut(s) 142
MaeI CTAG 1 cut(s) 33
MaeIII GTNAC 3 cut(s) 62, 86, 98
MmeI TCCRAC 1 cut(s) 151
MnlI CCTC 1 cut(s) 88
NlaIII CATG 1 cut(s) 142
NmuCI GTSAC 2 cut(s) 62, 86
NspI RCATGY 1 cut(s) 142
SgeI CNNG 3 cut(s) 45, 79, 151
SspMI CTAG 1 cut(s) 33
TaaI ACNGT 4 cut(s) 74, 92, 104, 135
TscAI CASTG 1 cut(s) 97
TseFI GTSAC 2 cut(s) 62, 86
Tsp45I GTSAC 2 cut(s) 62, 86
TspRI CASTG 1 cut(s) 97
XceI RCATGY 1 cut(s) 142
XspI CTAG 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.