Rw0G003220

Knottins

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Contig00110
Physical Location & Seq
Forward (+)
10513 .. 10671
159 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw0G003220.1

Sequence Viewer

Length: 159 bp
ATGCAGAGTGAAGCAAAGATCTGCGAGTACCCAAGCAGAACATTCAAAGGGCTGTGCGTCAAGGACAAAAACTGTGTCGTGAGATGTCGGAGTGAGGGTTACAATTACGGCAAATGCTCCCATGTCCGCCGACTATGTAGGTGCTTCAAACCTTGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

52

Amino Acids

6.08

Weight (kDa)

9.32

Isoelectric Point (pI)

33.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Gamma-thionin PF00304 6 - 52 2.2e-13 Gamma-thionin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 127
AfaI GTAC 1 cut(s) 29
AgsI TTSAA 2 cut(s) 46, 148
ArsI GACNNNNNNTTYG 2 cut(s) 60, 92
BceAI ACGGC 1 cut(s) 124
BglII AGATCT 1 cut(s) 18
BsaXI ACNNNNNCTCC 2 cut(s) 82, 112
Bsp143I GATC 1 cut(s) 18
BspACI CCGC 1 cut(s) 127
BssMI GATC 1 cut(s) 18
Bst4CI ACNGT 1 cut(s) 74
BstKTI GATC 1 cut(s) 21
BstMBI GATC 1 cut(s) 18
BstX2I RGATCY 1 cut(s) 18
BstYI RGATCY 1 cut(s) 18
CseI GACGC 1 cut(s) 46
Csp6I GTAC 1 cut(s) 28
CviAII CATG 1 cut(s) 122
CviJI RGCY 1 cut(s) 52
CviKI_1 RGCY 1 cut(s) 52
CviQI GTAC 1 cut(s) 28
DpnI GATC 1 cut(s) 20
DpnII GATC 1 cut(s) 18
EciI GGCGGA 1 cut(s) 116
FaeI CATG 1 cut(s) 125
FaiI YATR 2 cut(s) 123, 136
FatI CATG 1 cut(s) 121
HgaI GACGC 1 cut(s) 46
Hin1II CATG 1 cut(s) 125
Hpy188I TCNGA 1 cut(s) 90
Hpy188III TCNNGA 1 cut(s) 79
HpyCH4III ACNGT 1 cut(s) 74
HpyCH4V TGCA 1 cut(s) 4
Hsp92II CATG 1 cut(s) 125
Kzo9I GATC 1 cut(s) 18
LmnI GCTCC 1 cut(s) 122
MaeIII GTNAC 1 cut(s) 98
MalI GATC 1 cut(s) 20
MboI GATC 1 cut(s) 18
MflI RGATCY 1 cut(s) 18
MluCI AATT 1 cut(s) 103
MmeI TCCRAC 1 cut(s) 68
MnlI CCTC 1 cut(s) 88
NdeII GATC 1 cut(s) 18
NlaIII CATG 1 cut(s) 125
PsuI RGATCY 1 cut(s) 18
RsaI GTAC 1 cut(s) 29
RsaNI GTAC 1 cut(s) 28
Sau3AI GATC 1 cut(s) 18
SetI ASST 2 cut(s) 143, 154
SgeI CNNG 5 cut(s) 37, 45, 73, 91, 134
Sse9I AATT 1 cut(s) 103
SsiI CCGC 1 cut(s) 127
TaaI ACNGT 1 cut(s) 74
TasI AATT 1 cut(s) 103
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.