Rh5CG184000

Knottins

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
18422091 .. 18422407
317 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG184000.1

Sequence Viewer

Length: 225 bp
ATGGAGAGGAAGTACTTTGGGCTTGTTTTGTTCTTCATCATCCTCCTAACTTCTCAAGAGATGGTGATTCAGAGTGAAGCAAGAGTTTGCGAAGTGCCAAGCAAGACATTCAGCGGGCTGTGCTTCAGTGACACCCACTGCATCGTGAGATGCCACAGTGAGGGTTACGGTTACGGCAAATGCTCTCATATCCTGAGACGATGCAGATGCTTGAAGGCTTGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.5

Weight (kDa)

8.7

Isoelectric Point (pI)

57.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Gamma-thionin PF00304 28 - 74 5.8e-13 Gamma-thionin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 114
AcuI CTGAAG 1 cut(s) 109
AfaI GTAC 1 cut(s) 14
AfiI CCNNNNNNNGG 1 cut(s) 160
AgsI TTSAA 1 cut(s) 214
Alw26I GTCTC 1 cut(s) 190
AsuHPI GGTGA 1 cut(s) 76
BccI CCATC 1 cut(s) 55
BceAI ACGGC 1 cut(s) 190
BcgI CGANNNNNNTGC 2 cut(s) 189, 223
BcoDI GTCTC 1 cut(s) 190
BfaI CTAG 1 cut(s) 223
BmcAI AGTACT 1 cut(s) 14
BmsI GCATC 4 cut(s) 140, 150, 191, 197
BpuEI CTTGAG 1 cut(s) 39
BsaXI ACNNNNNCTCC 1 cut(s) 26
Bsc4I CCNNNNNNNGG 1 cut(s) 160
BseGI GGATG 1 cut(s) 39
BseLI CCNNNNNNNGG 1 cut(s) 160
BseMII CTCAG 1 cut(s) 185
BslI CCNNNNNNNGG 1 cut(s) 160
BsmAI GTCTC 1 cut(s) 190
BsmBI CGTCTC 1 cut(s) 190
BspACI CCGC 1 cut(s) 114
BspCNI CTCAG 1 cut(s) 186
Bst4CI ACNGT 2 cut(s) 158, 170
BstC8I GCNNGC 2 cut(s) 116, 220
BstDEI CTNAG 1 cut(s) 194
BstF5I GGATG 1 cut(s) 39
BstMAI GTCTC 1 cut(s) 190
BstMWI GCNNNNNNNGC 1 cut(s) 120
BtsCI GGATG 1 cut(s) 39
BtsI GCAGTG 1 cut(s) 136
BtsIMutI CAGTG 3 cut(s) 133, 136, 163
Cac8I GCNNGC 2 cut(s) 116, 220
Csp6I GTAC 1 cut(s) 13
CviJI RGCY 3 cut(s) 22, 118, 218
CviKI_1 RGCY 3 cut(s) 22, 118, 218
CviQI GTAC 1 cut(s) 13
DdeI CTNAG 1 cut(s) 194
Eco57I CTGAAG 1 cut(s) 109
Esp3I CGTCTC 1 cut(s) 190
FaiI YATR 1 cut(s) 189
FauI CCCGC 1 cut(s) 107
FokI GGATG 1 cut(s) 26
FspBI CTAG 1 cut(s) 223
HinfI GANTC 1 cut(s) 67
HphI GGTGA 1 cut(s) 76
Hpy188I TCNGA 1 cut(s) 72
Hpy188III TCNNGA 3 cut(s) 56, 145, 193
HpyAV CCTTC 1 cut(s) 208
HpyCH4III ACNGT 2 cut(s) 158, 170
HpyCH4V TGCA 2 cut(s) 141, 204
HpyF10VI GCNNNNNNNGC 1 cut(s) 120
HpyF3I CTNAG 1 cut(s) 194
LpnPI CCDG 1 cut(s) 206
LweI GCATC 4 cut(s) 140, 150, 191, 197
MaeI CTAG 1 cut(s) 223
MaeIII GTNAC 3 cut(s) 128, 164, 170
MboII GAAGA 1 cut(s) 25
MnlI CCTC 2 cut(s) 53, 154
MspA1I CMGCKG 1 cut(s) 114
MwoI GCNNNNNNNGC 1 cut(s) 120
NmuCI GTSAC 1 cut(s) 128
PfeI GAWTC 1 cut(s) 67
RsaI GTAC 1 cut(s) 14
RsaNI GTAC 1 cut(s) 13
ScaI AGTACT 1 cut(s) 14
SfaNI GCATC 4 cut(s) 140, 150, 191, 197
SgeI CNNG 8 cut(s) 35, 68, 93, 111, 115, 127, 157, 205
SmlI CTYRAG 1 cut(s) 54
SmoI CTYRAG 1 cut(s) 54
SsiI CCGC 1 cut(s) 114
SspMI CTAG 1 cut(s) 223
TaaI ACNGT 2 cut(s) 158, 170
TatI WGTACW 1 cut(s) 12
TfiI GAWTC 1 cut(s) 67
TscAI CASTG 3 cut(s) 133, 143, 163
TseFI GTSAC 1 cut(s) 128
Tsp45I GTSAC 1 cut(s) 128
TspDTI ATGAA 1 cut(s) 25
TspRI CASTG 3 cut(s) 133, 143, 163
XspI CTAG 1 cut(s) 223
ZrmI AGTACT 1 cut(s) 14
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.