MD06G1101000.v1.1

BEST Arabidopsis thaliana protein match is

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
Physical Location & Seq
Reverse (-)
23759262 .. 23759426
165 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1101000.v1.1.491

Sequence Viewer

Length: 165 bp
ATGCCTCTGCACTACCCAAGGTACCAGAAGAGTGACTATGAGAGCATGCCTGAGTGGAAACTGGACTGCCTTCTGAAGCAGTATGGCCTTCCAGTCATCGGAGATGTCAACCAAAAGAGGAAGTTTGCCATGGGGGCCTTCCTTTGGCCTTCCCAGTATGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.5

Weight (kDa)

7.86

Isoelectric Point (pI)

57.08

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF7722 PF24847 5 - 50 1.7e-30 Domain of unknown function (DUF7722)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 21
AccB1I GGYRCC 1 cut(s) 21
AcuI CTGAAG 1 cut(s) 95
AfaI GTAC 1 cut(s) 23
AfiI CCNNNNNNNGG 2 cut(s) 98, 144
AoxI GGCC 3 cut(s) 85, 135, 146
Asp718I GGTACC 1 cut(s) 21
AspS9I GGNCC 1 cut(s) 135
BanI GGYRCC 1 cut(s) 21
BglI GCCNNNNNGGC 1 cut(s) 134
BmgT120I GGNCC 1 cut(s) 135
BmiI GGNNCC 2 cut(s) 23, 136
BmrI ACTGGG 1 cut(s) 148
BmuI ACTGGG 1 cut(s) 148
BsaJI CCNNGG 2 cut(s) 17, 129
Bsc4I CCNNNNNNNGG 2 cut(s) 98, 144
Bse1I ACTGG 3 cut(s) 66, 92, 154
BseDI CCNNGG 2 cut(s) 17, 129
BseLI CCNNNNNNNGG 2 cut(s) 98, 144
BseMII CTCAG 1 cut(s) 42
BseNI ACTGG 3 cut(s) 66, 92, 154
BshFI GGCC 3 cut(s) 87, 137, 148
BshNI GGYRCC 1 cut(s) 21
BslI CCNNNNNNNGG 2 cut(s) 98, 144
BsnI GGCC 3 cut(s) 87, 137, 148
Bsp19I CCATGG 1 cut(s) 129
BspANI GGCC 3 cut(s) 87, 137, 148
BspCNI CTCAG 1 cut(s) 43
BspLI GGNNCC 2 cut(s) 23, 136
BspT107I GGYRCC 1 cut(s) 21
BsrI ACTGG 3 cut(s) 66, 92, 154
BssECI CCNNGG 2 cut(s) 17, 129
BssT1I CCWWGG 2 cut(s) 17, 129
Bst6I CTCTTC 1 cut(s) 23
BstC8I GCNNGC 1 cut(s) 47
BstDEI CTNAG 1 cut(s) 51
BstDSI CCRYGG 1 cut(s) 129
BstMWI GCNNNNNNNGC 1 cut(s) 134
BstNSI RCATGY 1 cut(s) 49
BsuRI GGCC 3 cut(s) 87, 137, 148
BtgI CCRYGG 1 cut(s) 129
Cac8I GCNNGC 1 cut(s) 47
Cfr13I GGNCC 1 cut(s) 135
Csp6I GTAC 1 cut(s) 22
CviAII CATG 2 cut(s) 46, 130
CviJI RGCY 3 cut(s) 87, 137, 148
CviKI_1 RGCY 3 cut(s) 87, 137, 148
CviQI GTAC 1 cut(s) 22
DdeI CTNAG 1 cut(s) 51
Eam1104I CTCTTC 1 cut(s) 23
EarI CTCTTC 1 cut(s) 23
Eco130I CCWWGG 2 cut(s) 17, 129
Eco57I CTGAAG 1 cut(s) 95
EcoO109I RGGNCCY 1 cut(s) 135
EcoT14I CCWWGG 2 cut(s) 17, 129
ErhI CCWWGG 2 cut(s) 17, 129
FaeI CATG 2 cut(s) 49, 133
FaiI YATR 5 cut(s) 39, 47, 84, 131, 159
FatI CATG 2 cut(s) 45, 129
HaeIII GGCC 3 cut(s) 87, 137, 148
Hin1II CATG 2 cut(s) 49, 133
HincII GTYRAC 1 cut(s) 109
HindII GTYRAC 1 cut(s) 109
Hpy166II GTNNAC 1 cut(s) 109
Hpy188I TCNGA 2 cut(s) 75, 101
Hpy8I GTNNAC 1 cut(s) 109
HpyAV CCTTC 4 cut(s) 80, 98, 148, 159
HpyCH4V TGCA 1 cut(s) 10
HpyF10VI GCNNNNNNNGC 1 cut(s) 134
HpyF3I CTNAG 1 cut(s) 51
Hsp92II CATG 2 cut(s) 49, 133
KpnI GGTACC 1 cut(s) 25
LpnPI CCDG 4 cut(s) 38, 47, 63, 105
MaeIII GTNAC 1 cut(s) 32
MboII GAAGA 1 cut(s) 40
MnlI CCTC 2 cut(s) 15, 111
MwoI GCNNNNNNNGC 1 cut(s) 134
NcoI CCATGG 1 cut(s) 129
NlaIII CATG 2 cut(s) 49, 133
NlaIV GGNNCC 2 cut(s) 23, 136
NmuCI GTSAC 1 cut(s) 32
NspI RCATGY 1 cut(s) 49
PaeI GCATGC 1 cut(s) 49
PspN4I GGNNCC 2 cut(s) 23, 136
PspPI GGNCC 1 cut(s) 135
RsaI GTAC 1 cut(s) 23
RsaNI GTAC 1 cut(s) 22
Sau96I GGNCC 1 cut(s) 135
SetI ASST 1 cut(s) 23
SgeI CNNG 7 cut(s) 30, 37, 58, 62, 74, 104, 142
SphI GCATGC 1 cut(s) 49
StyI CCWWGG 2 cut(s) 17, 129
TseFI GTSAC 1 cut(s) 32
Tsp45I GTSAC 1 cut(s) 32
XceI RCATGY 1 cut(s) 49
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.