Rmu_sc0007783.1_g000005

BEST Arabidopsis thaliana protein match is

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007783.1
Physical Location & Seq
Forward (+)
15208 .. 15444
237 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007783.1_g000005.1.cds

Sequence Viewer

Length: 237 bp
atgagtggaatgggagcgatgtcgtcttggtcacaagaaccaaatggacagcacaagagagagcgatgcgagtattttcagatgcccctgcactatccaaggtacaagaaatccgactatgagaccatgccggagtggaagcttgactgtttgcttagatcttatgggctaccgattactggagatgttgaagagaggaggaagtcagccatgggaaactttctgtggaataactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

9.3

Weight (kDa)

7.78

Isoelectric Point (pI)

74.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 104
AfiI CCNNNNNNNGG 1 cut(s) 179
AgsI TTSAA 1 cut(s) 191
AluBI AGCT 1 cut(s) 142
AluI AGCT 1 cut(s) 142
Alw26I GTCTC 1 cut(s) 116
BcoDI GTCTC 1 cut(s) 116
BfaI CTAG 1 cut(s) 235
BglII AGATCT 1 cut(s) 158
BmsI GCATC 2 cut(s) 56, 72
BpmI CTGGAG 1 cut(s) 201
BsaI GGTCTC 1 cut(s) 116
BsaJI CCNNGG 2 cut(s) 98, 210
Bsc4I CCNNNNNNNGG 1 cut(s) 179
Bse1I ACTGG 1 cut(s) 184
BseDI CCNNGG 2 cut(s) 98, 210
BseLI CCNNNNNNNGG 1 cut(s) 179
BseNI ACTGG 1 cut(s) 184
BseRI GAGGAG 1 cut(s) 211
BsgI GTGCAG 1 cut(s) 74
BsiSI CCGG 1 cut(s) 131
BslI CCNNNNNNNGG 1 cut(s) 179
BsmAI GTCTC 1 cut(s) 116
Bso31I GGTCTC 1 cut(s) 116
Bsp143I GATC 1 cut(s) 158
Bsp19I CCATGG 1 cut(s) 210
BspTNI GGTCTC 1 cut(s) 116
BsrI ACTGG 1 cut(s) 184
BssECI CCNNGG 2 cut(s) 98, 210
BssMI GATC 1 cut(s) 158
BssT1I CCWWGG 2 cut(s) 98, 210
Bst4CI ACNGT 1 cut(s) 149
Bst6I CTCTTC 1 cut(s) 186
BstDEI CTNAG 1 cut(s) 155
BstDSI CCRYGG 1 cut(s) 210
BstKTI GATC 1 cut(s) 161
BstMAI GTCTC 1 cut(s) 116
BstMBI GATC 1 cut(s) 158
BstX2I RGATCY 1 cut(s) 158
BstYI RGATCY 1 cut(s) 158
BtgI CCRYGG 1 cut(s) 210
BtgZI GCGATG 2 cut(s) 32, 79
Csp6I GTAC 1 cut(s) 103
CviAII CATG 2 cut(s) 127, 211
CviJI RGCY 3 cut(s) 142, 169, 209
CviKI_1 RGCY 3 cut(s) 142, 169, 209
CviQI GTAC 1 cut(s) 103
DdeI CTNAG 1 cut(s) 155
DpnI GATC 1 cut(s) 160
DpnII GATC 1 cut(s) 158
Eam1104I CTCTTC 1 cut(s) 186
EarI CTCTTC 1 cut(s) 186
Eco130I CCWWGG 2 cut(s) 98, 210
Eco31I GGTCTC 1 cut(s) 116
EcoT14I CCWWGG 2 cut(s) 98, 210
ErhI CCWWGG 2 cut(s) 98, 210
FaeI CATG 2 cut(s) 130, 214
FaiI YATR 4 cut(s) 120, 128, 165, 212
FatI CATG 2 cut(s) 126, 210
FspBI CTAG 1 cut(s) 235
GsuI CTGGAG 1 cut(s) 201
HapII CCGG 1 cut(s) 131
Hin1II CATG 2 cut(s) 130, 214
HindIII AAGCTT 1 cut(s) 140
HpaII CCGG 1 cut(s) 131
Hpy188I TCNGA 2 cut(s) 81, 115
HpyCH4III ACNGT 1 cut(s) 149
HpyCH4V TGCA 1 cut(s) 91
HpyF3I CTNAG 1 cut(s) 155
Hsp92II CATG 2 cut(s) 130, 214
Kzo9I GATC 1 cut(s) 158
LmnI GCTCC 1 cut(s) 14
LpnPI CCDG 3 cut(s) 101, 144, 165
LweI GCATC 2 cut(s) 56, 72
MaeI CTAG 1 cut(s) 235
MaeIII GTNAC 1 cut(s) 30
MalI GATC 1 cut(s) 160
MboI GATC 1 cut(s) 158
MboII GAAGA 1 cut(s) 203
MflI RGATCY 1 cut(s) 158
MmeI TCCRAC 1 cut(s) 138
MnlI CCTC 2 cut(s) 189, 192
MspI CCGG 1 cut(s) 131
NcoI CCATGG 1 cut(s) 210
NdeII GATC 1 cut(s) 158
NlaIII CATG 2 cut(s) 130, 214
NmuCI GTSAC 1 cut(s) 30
PsuI RGATCY 1 cut(s) 158
RsaI GTAC 1 cut(s) 104
RsaNI GTAC 1 cut(s) 103
Sau3AI GATC 1 cut(s) 158
SetI ASST 2 cut(s) 104, 144
SfaNI GCATC 2 cut(s) 56, 72
SspMI CTAG 1 cut(s) 235
StyI CCWWGG 2 cut(s) 98, 210
TaaI ACNGT 1 cut(s) 149
TseFI GTSAC 1 cut(s) 30
Tsp45I GTSAC 1 cut(s) 30
XspI CTAG 1 cut(s) 235
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.