Rmu_sc0002556.1_g000009

BEST Arabidopsis thaliana protein match is

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002556.1
Physical Location & Seq
Forward (+)
43485 .. 43730
246 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002556.1_g000009.1.cds

Sequence Viewer

Length: 246 bp
atgagcggaggcggcatggaagcggtgtcctctaggccacaagaggcgaatggccagcacaagcgagagaggtgtgttggctattttcagatgcctctgcactatccaaggtacaaaaaatcagactacgagatcatgccggaatggaagctggattgtctgcttaaacagtacggacttcaagtcactggagatgttgagcagaagaggaagtttgccatgggaactttcttgtggtctaactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

9.46

Weight (kDa)

8.98

Isoelectric Point (pI)

62.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 6
AciI CCGC 3 cut(s) 6, 12, 23
AcoI YGGCCR 1 cut(s) 52
AfaI GTAC 2 cut(s) 113, 173
AgsI TTSAA 1 cut(s) 182
AhdI GACNNNNNGTC 1 cut(s) 182
AluBI AGCT 1 cut(s) 151
AluI AGCT 1 cut(s) 151
AoxI GGCC 2 cut(s) 35, 52
BalI TGGCCA 1 cut(s) 54
BfaI CTAG 2 cut(s) 33, 244
BisI GCNGC 1 cut(s) 13
BlsI GCNGC 1 cut(s) 14
BmeRI GACNNNNNGTC 1 cut(s) 182
BmsI GCATC 1 cut(s) 81
BpmI CTGGAG 1 cut(s) 210
BsaJI CCNNGG 2 cut(s) 107, 219
Bse1I ACTGG 1 cut(s) 193
BseDI CCNNGG 2 cut(s) 107, 219
BseNI ACTGG 1 cut(s) 193
BsgI GTGCAG 1 cut(s) 83
BshFI GGCC 2 cut(s) 37, 54
BsiSI CCGG 1 cut(s) 140
BsnI GGCC 2 cut(s) 37, 54
Bsp143I GATC 1 cut(s) 132
Bsp19I CCATGG 1 cut(s) 219
BspACI CCGC 3 cut(s) 6, 12, 23
BspANI GGCC 2 cut(s) 37, 54
BsrBI CCGCTC 1 cut(s) 6
BsrI ACTGG 1 cut(s) 193
BssECI CCNNGG 2 cut(s) 107, 219
BssMI GATC 1 cut(s) 132
BssT1I CCWWGG 2 cut(s) 107, 219
Bst4CI ACNGT 1 cut(s) 171
Bst6I CTCTTC 1 cut(s) 200
BstC8I GCNNGC 1 cut(s) 56
BstDSI CCRYGG 1 cut(s) 219
BstKTI GATC 1 cut(s) 135
BstMBI GATC 1 cut(s) 132
BstMWI GCNNNNNNNGC 1 cut(s) 12
BsuRI GGCC 2 cut(s) 37, 54
BtgI CCRYGG 1 cut(s) 219
BtsIMutI CAGTG 1 cut(s) 186
Cac8I GCNNGC 1 cut(s) 56
Csp6I GTAC 2 cut(s) 112, 172
CviAII CATG 3 cut(s) 16, 136, 220
CviJI RGCY 4 cut(s) 37, 54, 81, 151
CviKI_1 RGCY 4 cut(s) 37, 54, 81, 151
CviQI GTAC 2 cut(s) 112, 172
DpnI GATC 1 cut(s) 134
DpnII GATC 1 cut(s) 132
DriI GACNNNNNGTC 1 cut(s) 182
EaeI YGGCCR 1 cut(s) 52
Eam1104I CTCTTC 1 cut(s) 200
Eam1105I GACNNNNNGTC 1 cut(s) 182
EarI CTCTTC 1 cut(s) 200
Eco130I CCWWGG 2 cut(s) 107, 219
EcoT14I CCWWGG 2 cut(s) 107, 219
ErhI CCWWGG 2 cut(s) 107, 219
FaeI CATG 3 cut(s) 19, 139, 223
FaiI YATR 3 cut(s) 17, 137, 221
FatI CATG 3 cut(s) 15, 135, 219
Fnu4HI GCNGC 1 cut(s) 13
Fsp4HI GCNGC 1 cut(s) 13
FspBI CTAG 2 cut(s) 33, 244
GluI GCNGC 1 cut(s) 13
GsuI CTGGAG 1 cut(s) 210
HaeIII GGCC 2 cut(s) 37, 54
HapII CCGG 1 cut(s) 140
Hin1II CATG 3 cut(s) 19, 139, 223
HpaII CCGG 1 cut(s) 140
Hpy188I TCNGA 2 cut(s) 90, 124
HpyCH4III ACNGT 1 cut(s) 171
HpyCH4V TGCA 1 cut(s) 100
HpyF10VI GCNNNNNNNGC 1 cut(s) 12
Hsp92II CATG 3 cut(s) 19, 139, 223
Kzo9I GATC 1 cut(s) 132
LpnPI CCDG 4 cut(s) 68, 137, 153, 174
LweI GCATC 1 cut(s) 81
MaeI CTAG 2 cut(s) 33, 244
MaeIII GTNAC 1 cut(s) 184
MalI GATC 1 cut(s) 134
MbiI CCGCTC 1 cut(s) 6
MboI GATC 1 cut(s) 132
MboII GAAGA 1 cut(s) 217
MlsI TGGCCA 1 cut(s) 54
MluNI TGGCCA 1 cut(s) 54
MnlI CCTC 5 cut(s) 37, 40, 63, 105, 201
Mox20I TGGCCA 1 cut(s) 54
MscI TGGCCA 1 cut(s) 54
MseI TTAA 1 cut(s) 165
Msp20I TGGCCA 1 cut(s) 54
MspI CCGG 1 cut(s) 140
MwoI GCNNNNNNNGC 1 cut(s) 12
NcoI CCATGG 1 cut(s) 219
NdeII GATC 1 cut(s) 132
NlaIII CATG 3 cut(s) 19, 139, 223
NmuCI GTSAC 1 cut(s) 184
PkrI GCNGC 1 cut(s) 14
RsaI GTAC 2 cut(s) 113, 173
RsaNI GTAC 2 cut(s) 112, 172
SaqAI TTAA 1 cut(s) 165
SatI GCNGC 1 cut(s) 13
Sau3AI GATC 1 cut(s) 132
SetI ASST 3 cut(s) 74, 113, 153
SfaNI GCATC 1 cut(s) 81
SsiI CCGC 3 cut(s) 6, 12, 23
SspMI CTAG 2 cut(s) 33, 244
StyI CCWWGG 2 cut(s) 107, 219
TaaI ACNGT 1 cut(s) 171
TauI GCSGC 1 cut(s) 15
Tru1I TTAA 1 cut(s) 165
Tru9I TTAA 1 cut(s) 165
TscAI CASTG 1 cut(s) 193
TseFI GTSAC 1 cut(s) 184
Tsp45I GTSAC 1 cut(s) 184
TspGWI ACGGA 1 cut(s) 189
TspRI CASTG 1 cut(s) 193
XspI CTAG 2 cut(s) 33, 244
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.