MD14G1120700.v1.1

BEST Arabidopsis thaliana protein match is

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr14
OG0002180
Physical Location & Seq
Reverse (-)
19519062 .. 19519331
270 bp
Loading structure...
UTR
Exon/CDS
Intron
MD14G1120700.v1.1.491

Sequence Viewer

Length: 270 bp
ATGAGTACCACTGGAACTGGCTTTAGCAACCACGCTTTCACCATGCCCGGCGGTCTCCAAGTAAATGAGCAAACTAGCAAGAACAACACCCCATGCAACTTCCAGATGCCTCTGCACTACCCAAGGTACCAGAAGAGTGACTATGAGAGCATGCCTGAATGGAAACTGGACTGCCTTATGAAGCAGTACGGCCTCCCACTCATTGGGGATGTCAACCAGAAGAGGAAGTTTGCCATGGGAGCCTTCCTTTGGCCTTCACAATACGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

10.26

Weight (kDa)

7.78

Isoelectric Point (pI)

47.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF7722 PF24847 40 - 85 1.6e-28 Domain of unknown function (DUF7722)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 126
AccB1I GGYRCC 1 cut(s) 126
AccB7I CCANNNNNTGG 1 cut(s) 203
AciI CCGC 1 cut(s) 51
AfaI GTAC 3 cut(s) 7, 128, 188
AfiI CCNNNNNNNGG 2 cut(s) 203, 249
Alw26I GTCTC 1 cut(s) 59
AoxI GGCC 2 cut(s) 190, 251
Asp718I GGTACC 1 cut(s) 126
AsuC2I CCSGG 1 cut(s) 48
AsuHPI GGTGA 1 cut(s) 31
BanI GGYRCC 1 cut(s) 126
BceAI ACGGC 1 cut(s) 205
BcnI CCSGG 1 cut(s) 48
BcoDI GTCTC 1 cut(s) 59
BfaI CTAG 1 cut(s) 75
Bme1390I CCNGG 1 cut(s) 48
BmiI GGNNCC 2 cut(s) 128, 241
BmrFI CCNGG 1 cut(s) 48
BmsI GCATC 1 cut(s) 96
BpuMI CCSGG 1 cut(s) 48
BsaI GGTCTC 1 cut(s) 59
BsaJI CCNNGG 2 cut(s) 122, 234
Bsc4I CCNNNNNNNGG 2 cut(s) 203, 249
Bse1I ACTGG 3 cut(s) 16, 22, 171
BseDI CCNNGG 2 cut(s) 122, 234
BseGI GGATG 1 cut(s) 214
BseLI CCNNNNNNNGG 2 cut(s) 203, 249
BseNI ACTGG 3 cut(s) 16, 22, 171
BsgI GTGCAG 1 cut(s) 98
BshFI GGCC 2 cut(s) 192, 253
BshNI GGYRCC 1 cut(s) 126
BsiSI CCGG 1 cut(s) 48
BslI CCNNNNNNNGG 2 cut(s) 203, 249
BsmAI GTCTC 1 cut(s) 59
BsnI GGCC 2 cut(s) 192, 253
Bso31I GGTCTC 1 cut(s) 59
Bsp19I CCATGG 1 cut(s) 234
BspACI CCGC 1 cut(s) 51
BspANI GGCC 2 cut(s) 192, 253
BspLI GGNNCC 2 cut(s) 128, 241
BspT107I GGYRCC 1 cut(s) 126
BspTNI GGTCTC 1 cut(s) 59
BsrI ACTGG 3 cut(s) 16, 22, 171
BssECI CCNNGG 2 cut(s) 122, 234
BssT1I CCWWGG 2 cut(s) 122, 234
Bst6I CTCTTC 2 cut(s) 128, 215
BstC8I GCNNGC 1 cut(s) 152
BstDSI CCRYGG 1 cut(s) 234
BstF5I GGATG 1 cut(s) 214
BstMAI GTCTC 1 cut(s) 59
BstMWI GCNNNNNNNGC 1 cut(s) 239
BstNSI RCATGY 1 cut(s) 154
BstSCI CCNGG 1 cut(s) 46
BsuRI GGCC 2 cut(s) 192, 253
BtgI CCRYGG 1 cut(s) 234
BtsCI GGATG 1 cut(s) 214
BtsIMutI CAGTG 1 cut(s) 9
Cac8I GCNNGC 1 cut(s) 152
Csp6I GTAC 3 cut(s) 6, 127, 187
CviAII CATG 4 cut(s) 43, 93, 151, 235
CviJI RGCY 4 cut(s) 21, 192, 242, 253
CviKI_1 RGCY 4 cut(s) 21, 192, 242, 253
CviQI GTAC 3 cut(s) 6, 127, 187
Eam1104I CTCTTC 2 cut(s) 128, 215
EarI CTCTTC 2 cut(s) 128, 215
Eco130I CCWWGG 2 cut(s) 122, 234
Eco31I GGTCTC 1 cut(s) 59
EcoT14I CCWWGG 2 cut(s) 122, 234
ErhI CCWWGG 2 cut(s) 122, 234
FaeI CATG 4 cut(s) 46, 96, 154, 238
FaiI YATR 6 cut(s) 44, 94, 144, 152, 179, 236
FatI CATG 4 cut(s) 42, 92, 150, 234
FokI GGATG 1 cut(s) 221
FspBI CTAG 1 cut(s) 75
HaeIII GGCC 2 cut(s) 192, 253
HapII CCGG 1 cut(s) 48
Hin1II CATG 4 cut(s) 46, 96, 154, 238
HincII GTYRAC 1 cut(s) 214
HindII GTYRAC 1 cut(s) 214
HpaII CCGG 1 cut(s) 48
HphI GGTGA 1 cut(s) 31
Hpy166II GTNNAC 1 cut(s) 214
Hpy188III TCNNGA 1 cut(s) 103
Hpy8I GTNNAC 1 cut(s) 214
HpyAV CCTTC 2 cut(s) 253, 264
HpyCH4V TGCA 2 cut(s) 96, 115
HpyF10VI GCNNNNNNNGC 1 cut(s) 239
Hsp92II CATG 4 cut(s) 46, 96, 154, 238
KpnI GGTACC 1 cut(s) 130
LmnI GCTCC 1 cut(s) 239
LpnPI CCDG 7 cut(s) 3, 61, 116, 143, 152, 168, 230
LweI GCATC 1 cut(s) 96
MaeI CTAG 1 cut(s) 75
MaeIII GTNAC 1 cut(s) 137
MboII GAAGA 2 cut(s) 145, 232
MnlI CCTC 3 cut(s) 120, 203, 216
MspI CCGG 1 cut(s) 48
MspR9I CCNGG 1 cut(s) 48
MwoI GCNNNNNNNGC 1 cut(s) 239
NciI CCSGG 1 cut(s) 48
NcoI CCATGG 1 cut(s) 234
NlaIII CATG 4 cut(s) 46, 96, 154, 238
NlaIV GGNNCC 2 cut(s) 128, 241
NmuCI GTSAC 1 cut(s) 137
NspI RCATGY 1 cut(s) 154
PaeI GCATGC 1 cut(s) 154
PflMI CCANNNNNTGG 1 cut(s) 203
PspN4I GGNNCC 2 cut(s) 128, 241
RsaI GTAC 3 cut(s) 7, 128, 188
RsaNI GTAC 3 cut(s) 6, 127, 187
ScrFI CCNGG 1 cut(s) 48
SetI ASST 1 cut(s) 128
SfaNI GCATC 1 cut(s) 96
SphI GCATGC 1 cut(s) 154
SsiI CCGC 1 cut(s) 51
SspMI CTAG 1 cut(s) 75
StyD4I CCNGG 1 cut(s) 46
StyI CCWWGG 2 cut(s) 122, 234
TscAI CASTG 1 cut(s) 16
TseFI GTSAC 1 cut(s) 137
Tsp45I GTSAC 1 cut(s) 137
TspDTI ATGAA 1 cut(s) 194
TspRI CASTG 1 cut(s) 16
Van91I CCANNNNNTGG 1 cut(s) 203
XceI RCATGY 1 cut(s) 154
XspI CTAG 1 cut(s) 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.