pycom01g23830

60S ribosomal Protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Forward (+)
21027379 .. 21028665
1287 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g23830.1

Sequence Viewer

Length: 294 bp
ATGCTCATTTTCCCATCAATGCCTCCATCACTAATGAGGCCAAGGAGATCGATCGAGATCCGTAACTTTTTGGGTGAAAAGAAGGTGAGAAAGGTGGATATGCTTGATGGTGTTTCCATCACCCGATCTGAGAAGGTCAAGGATGAGCTGATCTTGGATGGAAATGATATCGAGCTTGTTTCTCGGTCTTGTGCCCTGATCAACCAGAAATGCCATGTCAAGAACAAGGATATCAGGAAGTTTCTTGATGGTATCTATGTGAGCGAGAGGGGAACCATCCTTATAGATGAATGA

Protein Analysis

98

Amino Acids

11.17

Weight (kDa)

9.03

Isoelectric Point (pI)

62.33

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L6 PF00347 19 - 84 4e-12 Ribosomal protein L6
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 52
AluBI AGCT 2 cut(s) 148, 175
AluI AGCT 2 cut(s) 148, 175
AlwI GGATC 1 cut(s) 52
AoxI GGCC 1 cut(s) 38
AsuHPI GGTGA 3 cut(s) 86, 97, 112
BaeGI GKGCMC 1 cut(s) 196
BccI CCATC 7 cut(s) 22, 34, 101, 125, 152, 242, 284
BclI TGATCA 1 cut(s) 198
BmiI GGNNCC 1 cut(s) 274
Bsa29I ATCGAT 1 cut(s) 50
BsaBI GATNNNNATC 1 cut(s) 56
BsaJI CCNNGG 1 cut(s) 41
Bse8I GATNNNNATC 1 cut(s) 56
BseCI ATCGAT 1 cut(s) 50
BseDI CCNNGG 1 cut(s) 41
BseGI GGATG 3 cut(s) 148, 163, 276
BseJI GATNNNNATC 1 cut(s) 56
BseMII CTCAG 1 cut(s) 120
BseSI GKGCMC 1 cut(s) 196
Bsh1285I CGRYCG 1 cut(s) 54
BshFI GGCC 1 cut(s) 40
BshVI ATCGAT 1 cut(s) 50
BsiEI CGRYCG 1 cut(s) 54
BsnI GGCC 1 cut(s) 40
Bsp1286I GDGCHC 1 cut(s) 196
Bsp143I GATC 6 cut(s) 47, 51, 57, 125, 150, 198
BspANI GGCC 1 cut(s) 40
BspCNI CTCAG 1 cut(s) 121
BspDI ATCGAT 1 cut(s) 50
BspLI GGNNCC 1 cut(s) 274
BspPI GGATC 1 cut(s) 52
BssECI CCNNGG 1 cut(s) 41
BssMI GATC 6 cut(s) 47, 51, 57, 125, 150, 198
BssT1I CCWWGG 1 cut(s) 41
BstDEI CTNAG 1 cut(s) 129
BstF5I GGATG 3 cut(s) 148, 163, 276
BstKTI GATC 6 cut(s) 50, 54, 60, 128, 153, 201
BstMBI GATC 6 cut(s) 47, 51, 57, 125, 150, 198
BstMCI CGRYCG 1 cut(s) 54
BstSLI GKGCMC 1 cut(s) 196
BstX2I RGATCY 1 cut(s) 57
BstYI RGATCY 1 cut(s) 57
Bsu15I ATCGAT 1 cut(s) 50
BsuRI GGCC 1 cut(s) 40
BsuTUI ATCGAT 1 cut(s) 50
BtsCI GGATG 3 cut(s) 148, 163, 276
ClaI ATCGAT 1 cut(s) 50
CviAII CATG 1 cut(s) 215
CviJI RGCY 3 cut(s) 40, 148, 175
CviKI_1 RGCY 3 cut(s) 40, 148, 175
DdeI CTNAG 1 cut(s) 129
DpnI GATC 6 cut(s) 49, 53, 59, 127, 152, 200
DpnII GATC 6 cut(s) 47, 51, 57, 125, 150, 198
Eco130I CCWWGG 1 cut(s) 41
Eco32I GATATC 2 cut(s) 169, 232
EcoRV GATATC 2 cut(s) 169, 232
EcoT14I CCWWGG 1 cut(s) 41
ErhI CCWWGG 1 cut(s) 41
FaeI CATG 1 cut(s) 218
FaiI YATR 4 cut(s) 101, 216, 258, 284
FatI CATG 1 cut(s) 214
FbaI TGATCA 1 cut(s) 198
FokI GGATG 3 cut(s) 155, 170, 263
HaeIII GGCC 1 cut(s) 40
Hin1II CATG 1 cut(s) 218
HphI GGTGA 3 cut(s) 86, 97, 112
Hpy188I TCNGA 1 cut(s) 130
Hpy188III TCNNGA 4 cut(s) 55, 220, 235, 245
HpyAV CCTTC 2 cut(s) 76, 127
HpyF3I CTNAG 1 cut(s) 129
Hsp92II CATG 1 cut(s) 218
Ksp22I TGATCA 1 cut(s) 198
Kzo9I GATC 6 cut(s) 47, 51, 57, 125, 150, 198
LpnPI CCDG 3 cut(s) 209, 218, 220
MaeIII GTNAC 1 cut(s) 62
MalI GATC 6 cut(s) 49, 53, 59, 127, 152, 200
MboI GATC 6 cut(s) 47, 51, 57, 125, 150, 198
MflI RGATCY 1 cut(s) 57
MhlI GDGCHC 1 cut(s) 196
MnlI CCTC 3 cut(s) 30, 33, 261
NdeII GATC 6 cut(s) 47, 51, 57, 125, 150, 198
NlaIII CATG 1 cut(s) 218
NlaIV GGNNCC 1 cut(s) 274
Ple19I CGATCG 1 cut(s) 54
PspN4I GGNNCC 1 cut(s) 274
PsuI RGATCY 1 cut(s) 57
PvuI CGATCG 1 cut(s) 54
Sau3AI GATC 6 cut(s) 47, 51, 57, 125, 150, 198
SduI GDGCHC 1 cut(s) 196
SetI ASST 5 cut(s) 87, 96, 138, 150, 177
StyI CCWWGG 1 cut(s) 41
TaqI TCGA 3 cut(s) 50, 54, 171
TaqII GACCGA 1 cut(s) 174
TspGWI ACGGA 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.