pycom07g27520

60S ribosomal Protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Forward (+)
27222200 .. 27223449
1250 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g27520.1

Sequence Viewer

Length: 288 bp
ATGCTCATTTTCCCATCAATGCCTCCATCACTAATGAGGCCATCGATCGAGATCCGTAACTTTTTGGGTGAAAAGAAGGTGAGGAAGGTGGATATGCTTGACGGTGTTAATATCACTCGATCTGAGAAGGTCAAGGATGAGCTTATCTTGGATGGAAATGATATCGAGCTTGTTTCTCGGTCTTGTGCCCTGATCAACCAGAAATGCCATGTCAAGAACAAGGATATCAGGAAGTTTCTTGATGGTATCTATGTGAGCGAGAGGGGAACCATCGTTACAGACGAATGA

Protein Analysis

96

Amino Acids

10.86

Weight (kDa)

7.77

Isoelectric Point (pI)

56.41

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L6 PF00347 17 - 82 2.7e-12 Ribosomal protein L6
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 46
AluBI AGCT 2 cut(s) 142, 169
AluI AGCT 2 cut(s) 142, 169
AlwI GGATC 1 cut(s) 46
AoxI GGCC 1 cut(s) 38
AsuHPI GGTGA 2 cut(s) 80, 91
BaeGI GKGCMC 1 cut(s) 190
BccI CCATC 6 cut(s) 22, 34, 49, 146, 236, 278
BclI TGATCA 1 cut(s) 192
BmiI GGNNCC 1 cut(s) 268
Bsa29I ATCGAT 1 cut(s) 44
BsaBI GATNNNNATC 1 cut(s) 50
Bse8I GATNNNNATC 1 cut(s) 50
BseCI ATCGAT 1 cut(s) 44
BseGI GGATG 2 cut(s) 142, 157
BseJI GATNNNNATC 1 cut(s) 50
BseMII CTCAG 1 cut(s) 114
BseSI GKGCMC 1 cut(s) 190
Bsh1285I CGRYCG 1 cut(s) 48
BshFI GGCC 1 cut(s) 40
BshVI ATCGAT 1 cut(s) 44
BsiEI CGRYCG 1 cut(s) 48
BsnI GGCC 1 cut(s) 40
Bsp1286I GDGCHC 1 cut(s) 190
Bsp143I GATC 4 cut(s) 45, 51, 119, 192
BspANI GGCC 1 cut(s) 40
BspCNI CTCAG 1 cut(s) 115
BspDI ATCGAT 1 cut(s) 44
BspLI GGNNCC 1 cut(s) 268
BspPI GGATC 1 cut(s) 46
BssMI GATC 4 cut(s) 45, 51, 119, 192
Bst4CI ACNGT 1 cut(s) 104
BstDEI CTNAG 1 cut(s) 123
BstF5I GGATG 2 cut(s) 142, 157
BstKTI GATC 4 cut(s) 48, 54, 122, 195
BstMBI GATC 4 cut(s) 45, 51, 119, 192
BstMCI CGRYCG 1 cut(s) 48
BstSLI GKGCMC 1 cut(s) 190
BstX2I RGATCY 1 cut(s) 51
BstYI RGATCY 1 cut(s) 51
Bsu15I ATCGAT 1 cut(s) 44
BsuRI GGCC 1 cut(s) 40
BsuTUI ATCGAT 1 cut(s) 44
BtsCI GGATG 2 cut(s) 142, 157
ClaI ATCGAT 1 cut(s) 44
CviAII CATG 1 cut(s) 209
CviJI RGCY 3 cut(s) 40, 142, 169
CviKI_1 RGCY 3 cut(s) 40, 142, 169
DdeI CTNAG 1 cut(s) 123
DpnI GATC 4 cut(s) 47, 53, 121, 194
DpnII GATC 4 cut(s) 45, 51, 119, 192
Eco32I GATATC 2 cut(s) 163, 226
EcoRV GATATC 2 cut(s) 163, 226
FaeI CATG 1 cut(s) 212
FaiI YATR 3 cut(s) 95, 210, 252
FatI CATG 1 cut(s) 208
FbaI TGATCA 1 cut(s) 192
FokI GGATG 2 cut(s) 149, 164
HaeIII GGCC 1 cut(s) 40
Hin1II CATG 1 cut(s) 212
HphI GGTGA 2 cut(s) 80, 91
Hpy188I TCNGA 1 cut(s) 124
Hpy188III TCNNGA 4 cut(s) 49, 214, 229, 239
HpyAV CCTTC 3 cut(s) 70, 79, 121
HpyCH4III ACNGT 1 cut(s) 104
HpyF3I CTNAG 1 cut(s) 123
Hsp92II CATG 1 cut(s) 212
Ksp22I TGATCA 1 cut(s) 192
Kzo9I GATC 4 cut(s) 45, 51, 119, 192
LpnPI CCDG 3 cut(s) 203, 212, 214
MaeIII GTNAC 2 cut(s) 56, 274
MalI GATC 4 cut(s) 47, 53, 121, 194
MboI GATC 4 cut(s) 45, 51, 119, 192
MflI RGATCY 1 cut(s) 51
MhlI GDGCHC 1 cut(s) 190
MnlI CCTC 4 cut(s) 30, 33, 75, 255
MseI TTAA 1 cut(s) 108
NdeII GATC 4 cut(s) 45, 51, 119, 192
NlaIII CATG 1 cut(s) 212
NlaIV GGNNCC 1 cut(s) 268
PcsI WCGNNNNNNNCGW 1 cut(s) 279
Ple19I CGATCG 1 cut(s) 48
PspN4I GGNNCC 1 cut(s) 268
PsrI GAACNNNNNNTAC 1 cut(s) 259
PsuI RGATCY 1 cut(s) 51
PvuI CGATCG 1 cut(s) 48
SaqAI TTAA 1 cut(s) 108
Sau3AI GATC 4 cut(s) 45, 51, 119, 192
SduI GDGCHC 1 cut(s) 190
SetI ASST 5 cut(s) 81, 90, 132, 144, 171
TaaI ACNGT 1 cut(s) 104
TaqI TCGA 4 cut(s) 44, 48, 118, 165
TaqII GACCGA 1 cut(s) 168
Tru1I TTAA 1 cut(s) 108
Tru9I TTAA 1 cut(s) 108
TspGWI ACGGA 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.