pycom12g07060

60S ribosomal Protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Reverse (-)
7370090 .. 7370461
372 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g07060.1

Sequence Viewer

Length: 372 bp
ATGATGACCATCCTCTCCTTTGAGACCATGGACATCCCCGATGATGTCAAGATCGATGTCCAGGCCAATGATCGATCATCAAGGTTCTCACGGGAATACGACCAGAAAGCGGAAGCTGAAGGTCAAGGCCTGGTTCGGCTCCCTCAAAATCAGCCCCACCATCCGCACCGCTCTCTCCCACATCGGAAATCTCATCACCGACATCACCAAAGGGTATCGCTACAAGATGCGTTTGTGTATGCTAATTTTTCCATCAATGCCTTTATCACTAATGAGGCCAAGTTGATCGACACACGTAACTTTTTGTATATCAGGAAGTTTCTTGATGGTATCTATGTGAGCGAGAGGGGAACCATTGTTGCAGAGGAATGA

Protein Analysis

124

Amino Acids

14.39

Weight (kDa)

6.71

Isoelectric Point (pI)

31.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 171
AciI CCGC 3 cut(s) 110, 164, 169
AcuI CTGAAG 1 cut(s) 138
AfiI CCNNNNNNNGG 1 cut(s) 109
AflIII ACRYGT 1 cut(s) 293
AjnI CCWGG 2 cut(s) 60, 129
AluBI AGCT 1 cut(s) 116
AluI AGCT 1 cut(s) 116
Alw26I GTCTC 1 cut(s) 17
AoxI GGCC 3 cut(s) 63, 127, 276
AsuHPI GGTGA 2 cut(s) 188, 197
BccI CCATC 4 cut(s) 17, 168, 260, 320
BciT130I CCWGG 2 cut(s) 62, 131
BcoDI GTCTC 1 cut(s) 17
Bme1390I CCNGG 2 cut(s) 62, 131
BmiI GGNNCC 2 cut(s) 140, 352
BmrFI CCNGG 2 cut(s) 62, 131
BmsI GCATC 1 cut(s) 217
Bsa29I ATCGAT 2 cut(s) 54, 73
BsaAI YACGTR 1 cut(s) 296
BsaBI GATNNNNATC 1 cut(s) 8
BsaI GGTCTC 1 cut(s) 17
BsaJI CCNNGG 1 cut(s) 27
Bsc4I CCNNNNNNNGG 1 cut(s) 109
Bse8I GATNNNNATC 1 cut(s) 8
BseBI CCWGG 2 cut(s) 62, 131
BseCI ATCGAT 2 cut(s) 54, 73
BseDI CCNNGG 1 cut(s) 27
BseGI GGATG 3 cut(s) 9, 33, 160
BseJI GATNNNNATC 1 cut(s) 8
BseLI CCNNNNNNNGG 1 cut(s) 109
BshFI GGCC 3 cut(s) 65, 129, 278
BshVI ATCGAT 2 cut(s) 54, 73
BslI CCNNNNNNNGG 1 cut(s) 109
BsmAI GTCTC 1 cut(s) 17
BsnI GGCC 3 cut(s) 65, 129, 278
Bso31I GGTCTC 1 cut(s) 17
Bsp143I GATC 4 cut(s) 51, 70, 74, 285
Bsp19I CCATGG 1 cut(s) 27
BspACI CCGC 3 cut(s) 110, 164, 169
BspANI GGCC 3 cut(s) 65, 129, 278
BspDI ATCGAT 2 cut(s) 54, 73
BspLI GGNNCC 2 cut(s) 140, 352
BspTNI GGTCTC 1 cut(s) 17
BsrBI CCGCTC 1 cut(s) 171
BssECI CCNNGG 1 cut(s) 27
BssMI GATC 4 cut(s) 51, 70, 74, 285
BssT1I CCWWGG 1 cut(s) 27
Bst2UI CCWGG 2 cut(s) 62, 131
BstBAI YACGTR 1 cut(s) 296
BstDSI CCRYGG 1 cut(s) 27
BstF5I GGATG 3 cut(s) 9, 33, 160
BstKTI GATC 4 cut(s) 54, 73, 77, 288
BstMAI GTCTC 1 cut(s) 17
BstMBI GATC 4 cut(s) 51, 70, 74, 285
BstNI CCWGG 2 cut(s) 62, 131
BstSCI CCNGG 2 cut(s) 60, 129
Bsu15I ATCGAT 2 cut(s) 54, 73
BsuRI GGCC 3 cut(s) 65, 129, 278
BsuTUI ATCGAT 2 cut(s) 54, 73
BtgI CCRYGG 1 cut(s) 27
BtsCI GGATG 3 cut(s) 9, 33, 160
ClaI ATCGAT 2 cut(s) 54, 73
CviAII CATG 1 cut(s) 28
CviJI RGCY 6 cut(s) 65, 116, 129, 139, 154, 278
CviKI_1 RGCY 6 cut(s) 65, 116, 129, 139, 154, 278
DpnI GATC 4 cut(s) 53, 72, 76, 287
DpnII GATC 4 cut(s) 51, 70, 74, 285
Eco130I CCWWGG 1 cut(s) 27
Eco147I AGGCCT 1 cut(s) 129
Eco31I GGTCTC 1 cut(s) 17
Eco57I CTGAAG 1 cut(s) 138
EcoRII CCWGG 2 cut(s) 60, 129
EcoT14I CCWWGG 1 cut(s) 27
ErhI CCWWGG 1 cut(s) 27
FaeI CATG 1 cut(s) 31
FaiI YATR 4 cut(s) 29, 240, 309, 336
FatI CATG 1 cut(s) 27
FokI GGATG 2 cut(s) 20, 147
HaeIII GGCC 3 cut(s) 65, 129, 278
Hin1II CATG 1 cut(s) 31
HphI GGTGA 2 cut(s) 188, 197
Hpy188I TCNGA 1 cut(s) 186
Hpy188III TCNNGA 3 cut(s) 49, 313, 323
HpyAV CCTTC 1 cut(s) 113
HpyCH4IV ACGT 1 cut(s) 295
HpyCH4V TGCA 1 cut(s) 362
HpySE526I ACGT 1 cut(s) 295
Hsp92II CATG 1 cut(s) 31
Kzo9I GATC 4 cut(s) 51, 70, 74, 285
LmnI GCTCC 1 cut(s) 144
LpnPI CCDG 6 cut(s) 47, 74, 116, 116, 143, 298
LweI GCATC 1 cut(s) 217
MaeII ACGT 1 cut(s) 295
MaeIII GTNAC 1 cut(s) 296
MalI GATC 4 cut(s) 53, 72, 76, 287
MbiI CCGCTC 1 cut(s) 171
MboI GATC 4 cut(s) 51, 70, 74, 285
MluCI AATT 1 cut(s) 244
MnlI CCTC 5 cut(s) 23, 153, 268, 339, 358
MspR9I CCNGG 2 cut(s) 62, 131
MvaI CCWGG 2 cut(s) 62, 131
NcoI CCATGG 1 cut(s) 27
NdeII GATC 4 cut(s) 51, 70, 74, 285
NlaIII CATG 1 cut(s) 31
NlaIV GGNNCC 2 cut(s) 140, 352
PceI AGGCCT 1 cut(s) 129
Ppu21I YACGTR 1 cut(s) 296
Psp6I CCWGG 2 cut(s) 60, 129
PspGI CCWGG 2 cut(s) 60, 129
PspN4I GGNNCC 2 cut(s) 140, 352
Sau3AI GATC 4 cut(s) 51, 70, 74, 285
ScrFI CCNGG 2 cut(s) 62, 131
SetI ASST 4 cut(s) 86, 118, 124, 298
SfaNI GCATC 1 cut(s) 217
Sse9I AATT 1 cut(s) 244
SseBI AGGCCT 1 cut(s) 129
SsiI CCGC 3 cut(s) 110, 164, 169
StuI AGGCCT 1 cut(s) 129
StyD4I CCNGG 2 cut(s) 60, 129
StyI CCWWGG 1 cut(s) 27
TaiI ACGT 1 cut(s) 298
TaqI TCGA 3 cut(s) 54, 73, 288
TasI AATT 1 cut(s) 244
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.