Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0008563.1

Orthogroup ID

OG0001380

Physical Location & Seq

Genomic Coordinates Reverse (-)

16530 .. 16890

Gene Structure 361 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0008563.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 228 bp

atggtgttgctctgtcaggtgagaaaggtggatatgcttgatggtgtttctatcctccgatctgagaaggtgaaggatgagctgatattggatggcaatgatattgaacttgtttctcggtcttgtgctctgatcaaccagaaatgccatgtcaagaacaaggatatcaggaagtttcttgatggtatctatgttagcgagagggcaaccatcaatactgaggaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0002181 GO:0003002 GO:0003674 GO:0003676 GO:0003723 GO:0003735 GO:0005198 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005730 GO:0005737 GO:0005773 GO:0005774 GO:0005829 GO:0005840 GO:0005844 GO:0005886 GO:0005911 GO:0006412 GO:0006518 GO:0006807 GO:0007275 GO:0007389 GO:0008150 GO:0008152 GO:0009058 GO:0009059 GO:0009506 GO:0009507 GO:0009526 GO:0009536 GO:0009941 GO:0009955 GO:0009987 GO:0010467 GO:0015934 GO:0016020 GO:0019538 GO:0022625 GO:0022626 GO:0030054 GO:0031090 GO:0031967 GO:0031974 GO:0031975 GO:0031981 GO:0032501 GO:0032502 GO:0032991 GO:0034641 GO:0034645 GO:0042788 GO:0043043 GO:0043170 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0043603 GO:0043604 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044267 GO:0044271 GO:0044391 GO:0044422 GO:0044424 GO:0044428 GO:0044434 GO:0044435 GO:0044437 GO:0044444 GO:0044445 GO:0044446 GO:0044464 GO:0048856 GO:0055044 GO:0070013 GO:0071704 GO:0071944 GO:0097159 GO:0098588 GO:0098805 GO:1901363 GO:1901564 GO:1901566 GO:1901576 GO:1990904

KEGG Pathways

Metabolic & Signaling

ko03010 map03010

Pfam Domains

Protein Families

Ribosomal_L6

Protein Analysis

75

Amino Acids

8.56

Weight (kDa)

5.8

Isoelectric Point (pI)

50.17

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001380)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G33120 AT1G33140 AT4G10450 AT4G10450
fragaria_vesca	FvH4_5g10230 FvH4_7g33110
malus_domestica	MD01G1230300.v1.1 MD07G1302000.v1.1 MD16G1260300.v1.1
prunus_persica	Prupe.2G321000_v2.0.a1 Prupe.5G136400_v2.0.a1
pyrus_communis	pycom01g23830 pycom07g09170 pycom07g27520 pycom12g07060
rosa_chinensis	RchiOBHm_Chr1g0334541 RchiOBHm_Chr1g0334651 RchiOBHm_Chr1g0383161 RchiOBHm_Chr2g0169651 RchiOBHm_Chr3g0462551 RchiOBHm_Chr7g0187991
rosa_laevigata	RLG00000004736 RLG00000026125
rosa_multiflora	Rmu_sc0003624.1_g000019 Rmu_sc0005044.1_g000024 Rmu_sc0008563.1_g000005 Rmu_sc0013280.1_g000007 Rmu_sc0023940.1_g000001
rosa_roxburghii	Rroxscaffold_2G00081920 Rroxscaffold_3G00266830 Rroxscaffold_4G00277530
rosa_rugosa	Rorug01G0126100 Rorug01G0439300
rosa_samantha	Rh1AG139700 Rh1AG464900 Rh1BG422200 Rh1CG131600 Rh1CG435500 Rh1DG143700 Rh1DG153800 Rh1DG454900 Rh3AG115500 Rh3BG118900 Rh3CG122300 Rh7AG091500 Rh7BG093000 Rh7CG092300 Rh7DG093700
rosa_wichuraiana	Rw1G009540 Rw1G009550 Rw2G050900 Rw3G009780 Rw7G007890

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	107
AluBI	AGCT	1 cut(s)	82
AluI	AGCT	1 cut(s)	82
Alw21I	GWGCWC	1 cut(s)	130
AsuHPI	GGTGA	2 cut(s)	31, 82
Bbv12I	GWGCWC	1 cut(s)	130
BccI	CCATC	4 cut(s)	35, 86, 176, 218
BclI	TGATCA	1 cut(s)	132
Bse3DI	GCAATG	1 cut(s)	103
BseGI	GGATG	2 cut(s)	82, 97
BseMI	GCAATG	1 cut(s)	103
BseMII	CTCAG	2 cut(s)	54, 210
BsiHKAI	GWGCWC	1 cut(s)	130
Bsp1286I	GDGCHC	1 cut(s)	130
Bsp143I	GATC	2 cut(s)	59, 132
BspCNI	CTCAG	2 cut(s)	55, 211
BsrDI	GCAATG	1 cut(s)	103
BssMI	GATC	2 cut(s)	59, 132
BstDEI	CTNAG	2 cut(s)	63, 219
BstF5I	GGATG	2 cut(s)	82, 97
BstKTI	GATC	2 cut(s)	62, 135
BstMBI	GATC	2 cut(s)	59, 132
BtsCI	GGATG	2 cut(s)	82, 97
CviAII	CATG	1 cut(s)	149
CviJI	RGCY	1 cut(s)	82
CviKI_1	RGCY	1 cut(s)	82
DdeI	CTNAG	2 cut(s)	63, 219
DpnI	GATC	2 cut(s)	61, 134
DpnII	GATC	2 cut(s)	59, 132
Eco32I	GATATC	1 cut(s)	166
EcoRV	GATATC	1 cut(s)	166
FaeI	CATG	1 cut(s)	152
FaiI	YATR	3 cut(s)	35, 150, 192
FatI	CATG	1 cut(s)	148
FbaI	TGATCA	1 cut(s)	132
FokI	GGATG	2 cut(s)	89, 104
Hin1II	CATG	1 cut(s)	152
HphI	GGTGA	2 cut(s)	31, 82
Hpy188I	TCNGA	3 cut(s)	59, 64, 132
Hpy188III	TCNNGA	3 cut(s)	154, 169, 179
HpyAV	CCTTC	2 cut(s)	61, 67
HpyF3I	CTNAG	2 cut(s)	63, 219
Hsp92II	CATG	1 cut(s)	152
Ksp22I	TGATCA	1 cut(s)	132
Kzo9I	GATC	2 cut(s)	59, 132
LpnPI	CCDG	3 cut(s)	2, 152, 154
MalI	GATC	2 cut(s)	61, 134
MboI	GATC	2 cut(s)	59, 132
MhlI	GDGCHC	1 cut(s)	130
MnlI	CCTC	3 cut(s)	65, 195, 214
NdeII	GATC	2 cut(s)	59, 132
NlaIII	CATG	1 cut(s)	152
Sau3AI	GATC	2 cut(s)	59, 132
SduI	GDGCHC	1 cut(s)	130
SetI	ASST	4 cut(s)	21, 30, 72, 84
TaqII	GACCGA	1 cut(s)	108

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.