Rh1BG422200

60S ribosomal Protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Forward (+)
54192707 .. 54194503
1797 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG422200.1

Sequence Viewer

Length: 249 bp
ATGGTGTTGCTCTGTCAGGTGAGAAAGGTGGATATGCTTGATGGTGTTTCTATCCTCCGATCTGAGAAGGTGAAGGATGAGCTGATATTGGATGGCAATGATATTGAACTTGTTTCTCGGTCTTGTGCTCTGATCAACCAGAAATGCCTGTCAAGAACAAGGATATCAGGAAGTTTCTTGATGGTATCTATGTTAGCGAGAGGGCAACCATCAATACCGAGGAATGAAGGCTGTATTTTTCTTATGTGA

Protein Analysis

82

Amino Acids

9.16

Weight (kDa)

8.47

Isoelectric Point (pI)

42.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 107
AluBI AGCT 1 cut(s) 82
AluI AGCT 1 cut(s) 82
Alw21I GWGCWC 1 cut(s) 130
AsuHPI GGTGA 2 cut(s) 31, 82
Bbv12I GWGCWC 1 cut(s) 130
BccI CCATC 4 cut(s) 35, 86, 175, 217
BclI TGATCA 1 cut(s) 132
BsaJI CCNNGG 1 cut(s) 218
Bse3DI GCAATG 1 cut(s) 103
BseDI CCNNGG 1 cut(s) 218
BseGI GGATG 2 cut(s) 82, 97
BseMI GCAATG 1 cut(s) 103
BseMII CTCAG 1 cut(s) 54
BsiHKAI GWGCWC 1 cut(s) 130
Bsp1286I GDGCHC 1 cut(s) 130
Bsp143I GATC 2 cut(s) 59, 132
BspCNI CTCAG 1 cut(s) 55
BsrDI GCAATG 1 cut(s) 103
BssECI CCNNGG 1 cut(s) 218
BssMI GATC 2 cut(s) 59, 132
BstDEI CTNAG 1 cut(s) 63
BstF5I GGATG 2 cut(s) 82, 97
BstKTI GATC 2 cut(s) 62, 135
BstMBI GATC 2 cut(s) 59, 132
BtsCI GGATG 2 cut(s) 82, 97
CviJI RGCY 2 cut(s) 82, 231
CviKI_1 RGCY 2 cut(s) 82, 231
DdeI CTNAG 1 cut(s) 63
DpnI GATC 2 cut(s) 61, 134
DpnII GATC 2 cut(s) 59, 132
Eco32I GATATC 1 cut(s) 165
EcoRV GATATC 1 cut(s) 165
FaiI YATR 3 cut(s) 35, 191, 245
FbaI TGATCA 1 cut(s) 132
FokI GGATG 2 cut(s) 89, 104
HphI GGTGA 2 cut(s) 31, 82
Hpy188I TCNGA 3 cut(s) 59, 64, 132
Hpy188III TCNNGA 3 cut(s) 153, 168, 178
HpyAV CCTTC 3 cut(s) 61, 67, 221
HpyF3I CTNAG 1 cut(s) 63
Ksp22I TGATCA 1 cut(s) 132
Kzo9I GATC 2 cut(s) 59, 132
LpnPI CCDG 4 cut(s) 2, 152, 153, 161
MalI GATC 2 cut(s) 61, 134
MboI GATC 2 cut(s) 59, 132
MhlI GDGCHC 1 cut(s) 130
MnlI CCTC 3 cut(s) 65, 194, 213
NdeII GATC 2 cut(s) 59, 132
Sau3AI GATC 2 cut(s) 59, 132
SduI GDGCHC 1 cut(s) 130
SetI ASST 4 cut(s) 21, 30, 72, 84
TaqII GACCGA 1 cut(s) 108
TspDTI ATGAA 1 cut(s) 240
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.