RchiOBHm_Chr4g0395041

60S ribosomal protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
10809934 .. 10810522
589 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 210 bp
ATGTACTTCGAAGATAATGCTGCTGATATTGTTAATCCGAAGGCAGAAATGAAAGTTGCAGGATCTGCAATTACTGGTCCTATTGGGAAGGAGTGTGCTGATCTGTGGCCTAGGATTGCTACTGCTGTTAATGCTATTGTTTCAGTGATACCATCTTCCGACCATCTCTCGGCAGAAGACAGATCTTGGTGTTGTCCTTCTTTTGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

7.37

Weight (kDa)

4.56

Isoelectric Point (pI)

34.57

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L14 PF00238 2 - 45 2.7e-06 Ribosomal protein L14p/L23e
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 70
AfaI GTAC 1 cut(s) 5
AfiI CCNNNNNNNGG 1 cut(s) 169
AlwI GGATC 1 cut(s) 70
AlwNI CAGNNNCTG 1 cut(s) 65
AoxI GGCC 1 cut(s) 107
ApeKI GCWGC 1 cut(s) 20
AspA2I CCTAGG 1 cut(s) 110
AspS9I GGNCC 1 cut(s) 77
AsuII TTCGAA 1 cut(s) 9
AvaII GGWCC 1 cut(s) 77
AvrII CCTAGG 1 cut(s) 110
BbsI GAAGAC 1 cut(s) 183
BbvI GCAGC 1 cut(s) 7
BccI CCATC 2 cut(s) 160, 171
BcgI CGANNNNNNTGC 1 cut(s) 33
BfaI CTAG 1 cut(s) 111
BglII AGATCT 1 cut(s) 182
BisI GCNGC 1 cut(s) 21
BlnI CCTAGG 1 cut(s) 110
BlsI GCNGC 1 cut(s) 22
Bme18I GGWCC 1 cut(s) 77
BmgT120I GGNCC 1 cut(s) 77
BpiI GAAGAC 1 cut(s) 183
Bpu14I TTCGAA 1 cut(s) 9
BsaJI CCNNGG 1 cut(s) 110
Bsc4I CCNNNNNNNGG 1 cut(s) 169
Bse1I ACTGG 1 cut(s) 79
BseDI CCNNGG 1 cut(s) 110
BseLI CCNNNNNNNGG 1 cut(s) 169
BseNI ACTGG 1 cut(s) 79
BseXI GCAGC 1 cut(s) 7
BshFI GGCC 1 cut(s) 109
BslI CCNNNNNNNGG 1 cut(s) 169
BsnI GGCC 1 cut(s) 109
Bsp119I TTCGAA 1 cut(s) 9
Bsp143I GATC 3 cut(s) 62, 100, 182
BspANI GGCC 1 cut(s) 109
BspPI GGATC 1 cut(s) 70
BspT104I TTCGAA 1 cut(s) 9
BsrI ACTGG 1 cut(s) 79
BssECI CCNNGG 1 cut(s) 110
BssMI GATC 3 cut(s) 62, 100, 182
BssT1I CCWWGG 1 cut(s) 110
BstAPI GCANNNNNTGC 1 cut(s) 65
BstBI TTCGAA 1 cut(s) 9
BstKTI GATC 3 cut(s) 65, 103, 185
BstMBI GATC 3 cut(s) 62, 100, 182
BstMWI GCNNNNNNNGC 2 cut(s) 65, 131
BstV1I GCAGC 1 cut(s) 7
BstV2I GAAGAC 1 cut(s) 183
BstX2I RGATCY 2 cut(s) 62, 182
BstYI RGATCY 2 cut(s) 62, 182
BsuRI GGCC 1 cut(s) 109
BtsIMutI CAGTG 1 cut(s) 150
CaiI CAGNNNCTG 1 cut(s) 65
Cfr13I GGNCC 1 cut(s) 77
Csp6I GTAC 1 cut(s) 4
CviJI RGCY 1 cut(s) 109
CviKI_1 RGCY 1 cut(s) 109
CviQI GTAC 1 cut(s) 4
DpnI GATC 3 cut(s) 64, 102, 184
DpnII GATC 3 cut(s) 62, 100, 182
Eco130I CCWWGG 1 cut(s) 110
Eco47I GGWCC 1 cut(s) 77
EcoT14I CCWWGG 1 cut(s) 110
ErhI CCWWGG 1 cut(s) 110
Fnu4HI GCNGC 1 cut(s) 21
Fsp4HI GCNGC 1 cut(s) 21
FspBI CTAG 1 cut(s) 111
GluI GCNGC 1 cut(s) 21
HaeIII GGCC 1 cut(s) 109
Hpy188I TCNGA 2 cut(s) 39, 160
HpyAV CCTTC 3 cut(s) 34, 82, 207
HpyCH4V TGCA 2 cut(s) 59, 68
HpyF10VI GCNNNNNNNGC 2 cut(s) 65, 131
Kzo9I GATC 3 cut(s) 62, 100, 182
LpnPI CCDG 2 cut(s) 45, 60
Lsp1109I GCAGC 1 cut(s) 7
MaeI CTAG 1 cut(s) 111
MalI GATC 3 cut(s) 64, 102, 184
MboI GATC 3 cut(s) 62, 100, 182
MboII GAAGA 3 cut(s) 23, 147, 188
MflI RGATCY 2 cut(s) 62, 182
MluCI AATT 1 cut(s) 69
MmeI TCCRAC 1 cut(s) 183
MseI TTAA 2 cut(s) 33, 129
MwoI GCNNNNNNNGC 2 cut(s) 65, 131
NdeII GATC 3 cut(s) 62, 100, 182
NmeAIII GCCGAG 1 cut(s) 149
NspV TTCGAA 1 cut(s) 9
PkrI GCNGC 1 cut(s) 22
PspPI GGNCC 1 cut(s) 77
PstNI CAGNNNCTG 1 cut(s) 65
PsuI RGATCY 2 cut(s) 62, 182
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
SaqAI TTAA 2 cut(s) 33, 129
SatI GCNGC 1 cut(s) 21
Sau3AI GATC 3 cut(s) 62, 100, 182
Sau96I GGNCC 1 cut(s) 77
SfuI TTCGAA 1 cut(s) 9
SgeI CNNG 5 cut(s) 72, 87, 123, 181, 198
SinI GGWCC 1 cut(s) 77
Sse9I AATT 1 cut(s) 69
SspMI CTAG 1 cut(s) 111
StyI CCWWGG 1 cut(s) 110
TaqI TCGA 1 cut(s) 9
TasI AATT 1 cut(s) 69
TatI WGTACW 1 cut(s) 3
Tru1I TTAA 2 cut(s) 33, 129
Tru9I TTAA 2 cut(s) 33, 129
TscAI CASTG 1 cut(s) 150
TseI GCWGC 1 cut(s) 20
TspDTI ATGAA 1 cut(s) 65
TspRI CASTG 1 cut(s) 150
VpaK11BI GGWCC 1 cut(s) 77
XmaJI CCTAGG 1 cut(s) 110
XspI CTAG 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.