Rmu_sc0006211.1_g000006

large ribosomal subunit rRNA binding

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006211.1
Physical Location & Seq
Forward (+)
38502 .. 38836
335 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006211.1_g000006.1.cds

Sequence Viewer

Length: 210 bp
atgcttgcagcattgtattgtatggataatctttcatttatacttgttgttcatcacttattttgcttctgttcttcatttgcagataatgctggtgttattgtcaatccaaagggagaaatgaaagggtctgcaattactggtcctattgggaaggagtgtgctgatctatggccaaggattgccagtgctgctaatgctatcgtttaa

Protein Analysis

69

Amino Acids

7.31

Weight (kDa)

5.98

Isoelectric Point (pI)

17.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 173
AoxI GGCC 1 cut(s) 173
ApeKI GCWGC 2 cut(s) 8, 191
AspS9I GGNCC 1 cut(s) 143
AvaII GGWCC 1 cut(s) 143
BalI TGGCCA 1 cut(s) 175
BbvI GCAGC 2 cut(s) 20, 178
BisI GCNGC 2 cut(s) 9, 192
BlsI GCNGC 2 cut(s) 10, 193
Bme18I GGWCC 1 cut(s) 143
BmgT120I GGNCC 1 cut(s) 143
BsaJI CCNNGG 1 cut(s) 176
Bse1I ACTGG 2 cut(s) 145, 186
BseDI CCNNGG 1 cut(s) 176
BseNI ACTGG 2 cut(s) 145, 186
BseXI GCAGC 2 cut(s) 20, 178
BshFI GGCC 1 cut(s) 175
BsnI GGCC 1 cut(s) 175
Bsp143I GATC 1 cut(s) 166
BspANI GGCC 1 cut(s) 175
BsrI ACTGG 2 cut(s) 145, 186
BssECI CCNNGG 1 cut(s) 176
BssMI GATC 1 cut(s) 166
BssT1I CCWWGG 1 cut(s) 176
BstAPI GCANNNNNTGC 1 cut(s) 89
BstC8I GCNNGC 1 cut(s) 6
BstKTI GATC 1 cut(s) 169
BstMBI GATC 1 cut(s) 166
BstMWI GCNNNNNNNGC 3 cut(s) 89, 191, 197
BstV1I GCAGC 2 cut(s) 20, 178
BsuRI GGCC 1 cut(s) 175
BtsIMutI CAGTG 1 cut(s) 193
Cac8I GCNNGC 1 cut(s) 6
Cfr13I GGNCC 1 cut(s) 143
CviJI RGCY 1 cut(s) 175
CviKI_1 RGCY 1 cut(s) 175
DpnI GATC 1 cut(s) 168
DpnII GATC 1 cut(s) 166
EaeI YGGCCR 1 cut(s) 173
Eco130I CCWWGG 1 cut(s) 176
Eco47I GGWCC 1 cut(s) 143
EcoT14I CCWWGG 1 cut(s) 176
ErhI CCWWGG 1 cut(s) 176
FaiI YATR 3 cut(s) 23, 41, 172
Fnu4HI GCNGC 2 cut(s) 9, 192
Fsp4HI GCNGC 2 cut(s) 9, 192
GluI GCNGC 2 cut(s) 9, 192
HaeIII GGCC 1 cut(s) 175
HpyAV CCTTC 1 cut(s) 148
HpyCH4V TGCA 3 cut(s) 8, 83, 134
HpyF10VI GCNNNNNNNGC 3 cut(s) 89, 191, 197
Kzo9I GATC 1 cut(s) 166
LpnPI CCDG 3 cut(s) 78, 126, 199
Lsp1109I GCAGC 2 cut(s) 20, 178
MalI GATC 1 cut(s) 168
MboI GATC 1 cut(s) 166
MboII GAAGA 1 cut(s) 66
MlsI TGGCCA 1 cut(s) 175
MluCI AATT 1 cut(s) 135
MluNI TGGCCA 1 cut(s) 175
Mox20I TGGCCA 1 cut(s) 175
MscI TGGCCA 1 cut(s) 175
MseI TTAA 1 cut(s) 208
Msp20I TGGCCA 1 cut(s) 175
MwoI GCNNNNNNNGC 3 cut(s) 89, 191, 197
NdeII GATC 1 cut(s) 166
PkrI GCNGC 2 cut(s) 10, 193
PspPI GGNCC 1 cut(s) 143
SaqAI TTAA 1 cut(s) 208
SatI GCNGC 2 cut(s) 9, 192
Sau3AI GATC 1 cut(s) 166
Sau96I GGNCC 1 cut(s) 143
SgeI CNNG 6 cut(s) 17, 56, 105, 153, 189, 198
SinI GGWCC 1 cut(s) 143
Sse9I AATT 1 cut(s) 135
StyI CCWWGG 1 cut(s) 176
TasI AATT 1 cut(s) 135
Tru1I TTAA 1 cut(s) 208
Tru9I TTAA 1 cut(s) 208
TscAI CASTG 1 cut(s) 193
TseI GCWGC 2 cut(s) 8, 191
TspDTI ATGAA 4 cut(s) 24, 41, 66, 137
TspRI CASTG 1 cut(s) 193
VpaK11BI GGWCC 1 cut(s) 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.