RchiOBHm_Chr2g0129001

40S ribosomal protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
44499206 .. 44499439
234 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 234 bp
ATGCTGAGACTTACAAACTCTCTAATGATGCACGGAAGAAACAACAGGAAGAAACTGATGGCTGTCAGGATTATTAGGCACGCATTGGAGATTACCAATTTGCTAACTGATTTGAACCCCATCCATGTTATTGTCGACGCTGATGTCAATAGTGCTCCACATGAAGACGCAGTAGGTATTGGCTGTGCTAGTGTTGTTATCAGGCTGTGGATATCACACCATTCAGACGTGTGA

Protein Analysis

77

Amino Acids

8.61

Weight (kDa)

8.07

Isoelectric Point (pI)

24.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S7 PF00177 3 - 58 9.9e-08 Ribosomal protein S7p/S5e
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 143
AccI GTMKAC 1 cut(s) 135
AflIII ACRYGT 1 cut(s) 228
AgsI TTSAA 1 cut(s) 115
AjiI CACGTC 1 cut(s) 229
Alw21I GWGCWC 1 cut(s) 157
BbsI GAAGAC 1 cut(s) 171
Bbv12I GWGCWC 1 cut(s) 157
BccI CCATC 2 cut(s) 52, 128
BfaI CTAG 1 cut(s) 189
BmgBI CACGTC 1 cut(s) 229
BmsI GCATC 1 cut(s) 18
BpiI GAAGAC 1 cut(s) 171
BseGI GGATG 1 cut(s) 120
BsiHKAI GWGCWC 1 cut(s) 157
Bsp1286I GDGCHC 1 cut(s) 157
BstC8I GCNNGC 1 cut(s) 81
BstDEI CTNAG 1 cut(s) 5
BstF5I GGATG 1 cut(s) 120
BstV2I GAAGAC 1 cut(s) 171
BtrI CACGTC 1 cut(s) 229
BtsCI GGATG 1 cut(s) 120
Cac8I GCNNGC 1 cut(s) 81
CseI GACGC 2 cut(s) 146, 176
CviAII CATG 2 cut(s) 125, 161
CviJI RGCY 3 cut(s) 62, 183, 205
CviKI_1 RGCY 3 cut(s) 62, 183, 205
DdeI CTNAG 1 cut(s) 5
DrdI GACNNNNNNGTC 1 cut(s) 143
DseDI GACNNNNNNGTC 1 cut(s) 143
Eco32I GATATC 1 cut(s) 213
EcoRV GATATC 1 cut(s) 213
FaeI CATG 2 cut(s) 128, 164
FaiI YATR 2 cut(s) 126, 162
FatI CATG 2 cut(s) 124, 160
FblI GTMKAC 1 cut(s) 135
FokI GGATG 1 cut(s) 107
FspBI CTAG 1 cut(s) 189
HgaI GACGC 2 cut(s) 146, 176
Hin1II CATG 2 cut(s) 128, 164
HincII GTYRAC 1 cut(s) 136
HindII GTYRAC 1 cut(s) 136
Hpy166II GTNNAC 1 cut(s) 136
Hpy188I TCNGA 1 cut(s) 226
Hpy188III TCNNGA 1 cut(s) 67
Hpy8I GTNNAC 1 cut(s) 136
Hpy99I CGWCG 1 cut(s) 140
HpyCH4IV ACGT 1 cut(s) 228
HpyCH4V TGCA 1 cut(s) 31
HpyF3I CTNAG 1 cut(s) 5
HpySE526I ACGT 1 cut(s) 228
Hsp92II CATG 2 cut(s) 128, 164
LmnI GCTCC 1 cut(s) 160
LpnPI CCDG 3 cut(s) 31, 52, 187
LweI GCATC 1 cut(s) 18
MaeI CTAG 1 cut(s) 189
MaeII ACGT 1 cut(s) 228
MboII GAAGA 3 cut(s) 48, 61, 176
MhlI GDGCHC 1 cut(s) 157
MluCI AATT 1 cut(s) 97
NlaIII CATG 2 cut(s) 128, 164
SalI GTCGAC 1 cut(s) 134
SduI GDGCHC 1 cut(s) 157
SetI ASST 2 cut(s) 178, 231
SfaNI GCATC 1 cut(s) 18
SgeI CNNG 8 cut(s) 44, 58, 79, 92, 137, 173, 201, 214
Sse9I AATT 1 cut(s) 97
SspMI CTAG 1 cut(s) 189
TaiI ACGT 1 cut(s) 231
TaqI TCGA 1 cut(s) 135
TasI AATT 1 cut(s) 97
TspDTI ATGAA 1 cut(s) 177
TspGWI ACGGA 1 cut(s) 48
XmiI GTMKAC 1 cut(s) 135
XspI CTAG 1 cut(s) 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.