Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8311483.1

Orthogroup ID

OG0001136

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 189

Gene Structure 189 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8311483.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 189 bp

aggaagaaactgatggctgtcaggattattaggcacgcattggagattaccaatttgctaactgatttgaaccccatccatgttattgtcgacgctgatgtcaatagtgctccacatgaagacgcagtaggtattggctgtgctagtgttgttatcaggctgtggatatcacaccattcagacgtgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000028 GO:0003674 GO:0003676 GO:0003723 GO:0003729 GO:0003735 GO:0005198 GO:0005488 GO:0005575 GO:0005618 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005774 GO:0005829 GO:0005840 GO:0005844 GO:0005886 GO:0005911 GO:0006412 GO:0006518 GO:0006807 GO:0006996 GO:0008150 GO:0008152 GO:0009058 GO:0009059 GO:0009506 GO:0009507 GO:0009536 GO:0009719 GO:0009725 GO:0009735 GO:0009987 GO:0010033 GO:0010467 GO:0015935 GO:0016020 GO:0016043 GO:0019538 GO:0019843 GO:0022607 GO:0022613 GO:0022618 GO:0022626 GO:0022627 GO:0030054 GO:0030312 GO:0031090 GO:0032991 GO:0034622 GO:0034641 GO:0034645 GO:0042221 GO:0042254 GO:0042255 GO:0042274 GO:0042788 GO:0043043 GO:0043170 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043603 GO:0043604 GO:0043933 GO:0044085 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044267 GO:0044271 GO:0044391 GO:0044422 GO:0044424 GO:0044437 GO:0044444 GO:0044445 GO:0044446 GO:0044464 GO:0050896 GO:0055044 GO:0065003 GO:0070925 GO:0071704 GO:0071826 GO:0071840 GO:0071944 GO:0097159 GO:0098588 GO:0098805 GO:1901363 GO:1901564 GO:1901566 GO:1901576 GO:1990904

KEGG Pathways

Metabolic & Signaling

ko03010 map03010

Pfam Domains

Protein Families

Ribosomal_S7

Protein Analysis

62

Amino Acids

6.84

Weight (kDa)

6.54

Isoelectric Point (pI)

17.9

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001136)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G37270 AT2G37270 AT3G11940 AT3G11940
fragaria_vesca	FvH4_2g26500 FvH4_3g33535 FvH4_4g10002 FvH4_5g31441 FvH4_6g14761 FvH4_6g21310 FvH4_6g21310
malus_domestica	MD04G1033100.v1.1 MD12G1044700.v1.1 MD12G1049500.v1.1 MD12G1049600.v1.1 MD14G1043500.v1.1 MD14G1048400.v1.1 MD14G1048600.v1.1
prunus_persica	Prupe.1G502000_v2.0.a1 Prupe.7G086600_v2.0.a1 Prupe.7G086600_v2.0.a1 Prupe.7G086600_v2.0.a1 Prupe.7G086600_v2.0.a1 Prupe.7G086700_v2.0.a1 Prupe.7G086700_v2.0.a1
pyrus_communis	pycom04g02720 pycom12g03850 pycom13g28970 pycom14g00940 pycom14g03700
rosa_chinensis	RchiOBHm_Chr0c36g0502911 RchiOBHm_Chr2g0129001 RchiOBHm_Chr3g0477901 RchiOBHm_Chr6g0295301
rosa_laevigata	RLG00000011814 RLG00000023680
rosa_multiflora	Rmu_co8311483.1_g000001 Rmu_sc0005991.1_g000014 Rmu_sc0007232.1_g000007
rosa_roxburghii	Rroxscaffold_171G00441470 Rroxscaffold_4G00298910 Rroxscaffold_6G00403610 Rroxscaffold_7G00172590
rosa_rugosa	Rorug01G0206000 Rorug03G0163800 Rorug03G0163800 Rorug06G0250000
rosa_samantha	Rh3CG242100 Rh3DG241400 Rh6AG363100 Rh6BG371100 Rh6CG377700 Rh6DG363800
rosa_wichuraiana	Rw0G008510 Rw2G027230 Rw3G019340 Rw6G026660 Rw6G031680

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	98
AccI	GTMKAC	1 cut(s)	90
AflIII	ACRYGT	1 cut(s)	183
AgsI	TTSAA	1 cut(s)	70
AjiI	CACGTC	1 cut(s)	184
Alw21I	GWGCWC	1 cut(s)	112
BbsI	GAAGAC	1 cut(s)	126
Bbv12I	GWGCWC	1 cut(s)	112
BccI	CCATC	2 cut(s)	7, 83
BfaI	CTAG	1 cut(s)	144
BmgBI	CACGTC	1 cut(s)	184
BpiI	GAAGAC	1 cut(s)	126
BseGI	GGATG	1 cut(s)	75
BsiHKAI	GWGCWC	1 cut(s)	112
Bsp1286I	GDGCHC	1 cut(s)	112
BstC8I	GCNNGC	1 cut(s)	36
BstF5I	GGATG	1 cut(s)	75
BstV2I	GAAGAC	1 cut(s)	126
BtrI	CACGTC	1 cut(s)	184
BtsCI	GGATG	1 cut(s)	75
Cac8I	GCNNGC	1 cut(s)	36
CseI	GACGC	2 cut(s)	101, 131
CviAII	CATG	2 cut(s)	80, 116
CviJI	RGCY	3 cut(s)	17, 138, 160
CviKI_1	RGCY	3 cut(s)	17, 138, 160
DrdI	GACNNNNNNGTC	1 cut(s)	98
DseDI	GACNNNNNNGTC	1 cut(s)	98
Eco32I	GATATC	1 cut(s)	168
EcoRV	GATATC	1 cut(s)	168
FaeI	CATG	2 cut(s)	83, 119
FaiI	YATR	2 cut(s)	81, 117
FatI	CATG	2 cut(s)	79, 115
FblI	GTMKAC	1 cut(s)	90
FokI	GGATG	1 cut(s)	62
FspBI	CTAG	1 cut(s)	144
HgaI	GACGC	2 cut(s)	101, 131
Hin1II	CATG	2 cut(s)	83, 119
HincII	GTYRAC	1 cut(s)	91
HindII	GTYRAC	1 cut(s)	91
Hpy166II	GTNNAC	1 cut(s)	91
Hpy188I	TCNGA	1 cut(s)	181
Hpy188III	TCNNGA	1 cut(s)	22
Hpy8I	GTNNAC	1 cut(s)	91
Hpy99I	CGWCG	1 cut(s)	95
HpyCH4IV	ACGT	1 cut(s)	183
HpySE526I	ACGT	1 cut(s)	183
Hsp92II	CATG	2 cut(s)	83, 119
LmnI	GCTCC	1 cut(s)	115
LpnPI	CCDG	2 cut(s)	7, 142
MaeI	CTAG	1 cut(s)	144
MaeII	ACGT	1 cut(s)	183
MboII	GAAGA	2 cut(s)	16, 131
MhlI	GDGCHC	1 cut(s)	112
MluCI	AATT	1 cut(s)	52
NlaIII	CATG	2 cut(s)	83, 119
SalI	GTCGAC	1 cut(s)	89
SduI	GDGCHC	1 cut(s)	112
SetI	ASST	2 cut(s)	133, 186
SgeI	CNNG	6 cut(s)	34, 47, 92, 128, 156, 169
Sse9I	AATT	1 cut(s)	52
SspMI	CTAG	1 cut(s)	144
TaiI	ACGT	1 cut(s)	186
TaqI	TCGA	1 cut(s)	90
TasI	AATT	1 cut(s)	52
TspDTI	ATGAA	1 cut(s)	132
XmiI	GTMKAC	1 cut(s)	90
XspI	CTAG	1 cut(s)	144

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.