RchiOBHm_Chr2g0147411

B3 domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
65044487 .. 65046742
2256 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 429 bp
ATGGCCAAATCTTCATCGAATCCTGTAGTTGAATTGAATGGACAGGAATTCTGGCCACTTTCTGGGAAACCATACTTTGACGTCATACTCACGAAATCACATGTGAAACCCATTTACCAACTGGGGATCCCAGCCAAACTTGAACCAGTACTACCCTCTGGTTCAATACATACAGTTCTCACATTTGGGGCTAAGAGCTGGGAGATGACCTATAATGGAGAAAAACGTCATAAACAATTCGATCGAAAGTCATGGGGAGCATTTGTCGATGAAAACAATTTGAAGGCTGGAGATGGATTGGTGTTTGAACTCAAGGAGTGCAATAGCACACAAATAGGATTCAGAGTCCAAATCCTGAGAGGTGACATCCCTGACGAACTTCTAGAAAAGGCCAACTGTGAGGCAGAGAAACCCATTTTCATACAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

142

Amino Acids

15.98

Weight (kDa)

6.3

Isoelectric Point (pI)

25.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
B3 PF02362 26 - 110 5.5e-09 B3 DNA binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000623)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g35581 FvH4_6g35581 FvH4_6g35582 FvH4_7g07710 FvH4_7g07720
malus_domestica MD02G1233300.v1.1 MD07G1080300.v1.1
prunus_persica Prupe.2G100300_v2.0.a1 Prupe.2G100300_v2.0.a1 Prupe.2G100300_v2.0.a1 Prupe.2G100300_v2.0.a1 Prupe.2G104300_v2.0.a1 Prupe.2G104700_v2.0.a1 Prupe.2G104700_v2.0.a1 Prupe.2G104700_v2.0.a1
pyrus_communis pycom02g20150 pycom07g06390
rosa_chinensis RchiOBHm_Chr1g0342371 RchiOBHm_Chr1g0342381 RchiOBHm_Chr1g0342401 RchiOBHm_Chr1g0342491 RchiOBHm_Chr1g0342511 RchiOBHm_Chr2g0147401 RchiOBHm_Chr2g0147411
rosa_laevigata RLG00000020253 RLG00000020259 RLG00000029157 RLG00000029158
rosa_multiflora Rmu_sc0000979.1_g000010 Rmu_sc0001159.1_g000034 Rmu_sc0001159.1_g000035 Rmu_sc0005388.1_g000001 Rmu_sc0009535.1_g000001 Rmu_sc0009535.1_g000003 Rmu_sc0011976.1_g000004 Rmu_sc0011976.1_g000005 Rmu_sc0027133.1_g000002
rosa_roxburghii Rroxscaffold_2G00099550 Rroxscaffold_2G00099560 Rroxscaffold_4G00296180 Rroxscaffold_4G00312990 Rroxscaffold_4G00313010 Rroxscaffold_4G00313030 Rroxscaffold_4G00313060
rosa_rugosa Rorug01G0150600.1 Rorug01G0150700.1 Rorug01G0150800.1 Rorug01G0150900.1 Rorug01G0151000.1 Rorug01G0151100.1 Rorug01G0151200.1 Rorug01G0151300.1 Rorug01G0151400.1 Rorug02G0399500 Rorug02G0399600 Rorug02G0399700 Rorug02G0399800 Rorug02G0399800 Rorug02G0399900
rosa_samantha Rh1AG165800 Rh1AG165900 Rh1BG132300 Rh1BG132400 Rh1CG154400 Rh1CG154500 Rh1DG167200 Rh1DG167300 Rh2AG456600 Rh2AG456700 Rh2BG469100 Rh2CG444100 Rh2CG444200 Rh2DG478400 Rh2DG478500
rosa_wichuraiana Rw1G013810 Rw1G013820 Rw1G013860 Rw2G037370 Rw2G037380

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 84
AccB7I CCANNNNNTGG 1 cut(s) 62
AclWI GGATC 2 cut(s) 121, 134
AcoI YGGCCR 2 cut(s) 3, 53
AcsI RAATTY 1 cut(s) 47
AcyI GRCGYC 1 cut(s) 81
AfaI GTAC 1 cut(s) 150
AfiI CCNNNNNNNGG 1 cut(s) 62
AflIII ACRYGT 1 cut(s) 100
AgsI TTSAA 6 cut(s) 32, 37, 143, 165, 283, 308
AluBI AGCT 1 cut(s) 198
AluI AGCT 1 cut(s) 198
AlwI GGATC 2 cut(s) 121, 134
AoxI GGCC 3 cut(s) 3, 53, 390
ApoI RAATTY 1 cut(s) 47
AsuHPI GGTGA 1 cut(s) 374
BalI TGGCCA 2 cut(s) 5, 55
BamHI GGATCC 1 cut(s) 126
BccI CCATC 1 cut(s) 287
BfaI CTAG 1 cut(s) 383
BfmI CTRYAG 1 cut(s) 24
BmcAI AGTACT 1 cut(s) 150
BmiI GGNNCC 1 cut(s) 128
BmrI ACTGGG 1 cut(s) 131
BmuI ACTGGG 1 cut(s) 131
BpmI CTGGAG 1 cut(s) 309
BpuEI CTTGAG 1 cut(s) 296
BsaHI GRCGYC 1 cut(s) 81
BsaXI ACNNNNNCTCC 2 cut(s) 249, 279
Bsc4I CCNNNNNNNGG 1 cut(s) 62
Bse1I ACTGG 2 cut(s) 126, 146
BseGI GGATG 1 cut(s) 366
BseLI CCNNNNNNNGG 1 cut(s) 62
BseMII CTCAG 1 cut(s) 347
BseNI ACTGG 2 cut(s) 126, 146
BseYI CCCAGC 2 cut(s) 130, 198
Bsh1285I CGRYCG 1 cut(s) 244
BshFI GGCC 3 cut(s) 5, 55, 392
BsiEI CGRYCG 1 cut(s) 244
BslI CCNNNNNNNGG 1 cut(s) 62
BsnI GGCC 3 cut(s) 5, 55, 392
Bsp143I GATC 2 cut(s) 126, 241
BspANI GGCC 3 cut(s) 5, 55, 392
BspCNI CTCAG 1 cut(s) 348
BspLI GGNNCC 1 cut(s) 128
BspPI GGATC 2 cut(s) 121, 134
BsrI ACTGG 2 cut(s) 126, 146
BssMI GATC 2 cut(s) 126, 241
BssNI GRCGYC 1 cut(s) 81
Bst4CI ACNGT 2 cut(s) 175, 398
BstACI GRCGYC 1 cut(s) 81
BstDEI CTNAG 2 cut(s) 192, 356
BstF5I GGATG 1 cut(s) 366
BstKTI GATC 2 cut(s) 129, 244
BstMBI GATC 2 cut(s) 126, 241
BstMCI CGRYCG 1 cut(s) 244
BstNSI RCATGY 1 cut(s) 104
BstSFI CTRYAG 1 cut(s) 24
BstX2I RGATCY 1 cut(s) 126
BstYI RGATCY 1 cut(s) 126
BsuRI GGCC 3 cut(s) 5, 55, 392
BtsCI GGATG 1 cut(s) 366
Csp6I GTAC 1 cut(s) 149
CviAII CATG 2 cut(s) 101, 252
CviJI RGCY 7 cut(s) 5, 55, 134, 191, 198, 287, 392
CviKI_1 RGCY 7 cut(s) 5, 55, 134, 191, 198, 287, 392
CviQI GTAC 1 cut(s) 149
DdeI CTNAG 2 cut(s) 192, 356
DpnI GATC 2 cut(s) 128, 243
DpnII GATC 2 cut(s) 126, 241
EaeI YGGCCR 2 cut(s) 3, 53
EcoRI GAATTC 1 cut(s) 47
FaeI CATG 2 cut(s) 104, 255
FaiI YATR 8 cut(s) 73, 86, 102, 171, 213, 231, 253, 422
FatI CATG 2 cut(s) 100, 251
FokI GGATG 1 cut(s) 353
FspBI CTAG 1 cut(s) 383
GsaI CCCAGC 2 cut(s) 134, 202
GsuI CTGGAG 1 cut(s) 309
HaeIII GGCC 3 cut(s) 5, 55, 392
Hin1I GRCGYC 1 cut(s) 81
Hin1II CATG 2 cut(s) 104, 255
HinfI GANTC 3 cut(s) 19, 339, 345
HphI GGTGA 1 cut(s) 374
Hpy188I TCNGA 1 cut(s) 344
Hpy188III TCNNGA 3 cut(s) 91, 355, 383
HpyAV CCTTC 1 cut(s) 277
HpyCH4III ACNGT 2 cut(s) 175, 398
HpyCH4IV ACGT 2 cut(s) 81, 226
HpyCH4V TGCA 1 cut(s) 321
HpyF3I CTNAG 2 cut(s) 192, 356
HpySE526I ACGT 2 cut(s) 81, 226
Hsp92I GRCGYC 1 cut(s) 81
Hsp92II CATG 2 cut(s) 104, 255
Kzo9I GATC 2 cut(s) 126, 241
LmnI GCTCC 1 cut(s) 257
MaeI CTAG 1 cut(s) 383
MaeII ACGT 2 cut(s) 81, 226
MaeIII GTNAC 1 cut(s) 362
MalI GATC 2 cut(s) 128, 243
MboI GATC 2 cut(s) 126, 241
MboII GAAGA 1 cut(s) 3
MflI RGATCY 1 cut(s) 126
MlsI TGGCCA 2 cut(s) 5, 55
MluCI AATT 4 cut(s) 32, 47, 236, 277
MluNI TGGCCA 2 cut(s) 5, 55
MlyI GAGTC 1 cut(s) 354
MnlI CCTC 3 cut(s) 166, 353, 394
Mox20I TGGCCA 2 cut(s) 5, 55
MscI TGGCCA 2 cut(s) 5, 55
Msp20I TGGCCA 2 cut(s) 5, 55
NdeII GATC 2 cut(s) 126, 241
NlaIII CATG 2 cut(s) 104, 255
NlaIV GGNNCC 1 cut(s) 128
NmuCI GTSAC 1 cut(s) 362
NspI RCATGY 1 cut(s) 104
PciI ACATGT 1 cut(s) 100
PfeI GAWTC 2 cut(s) 19, 339
PflMI CCANNNNNTGG 1 cut(s) 62
Ple19I CGATCG 1 cut(s) 244
PleI GAGTC 1 cut(s) 353
PpsI GAGTC 1 cut(s) 353
PscI ACATGT 1 cut(s) 100
PspFI CCCAGC 2 cut(s) 130, 198
PspN4I GGNNCC 1 cut(s) 128
PsrI GAACNNNNNNTAC 2 cut(s) 135, 167
PsuI RGATCY 1 cut(s) 126
PvuI CGATCG 1 cut(s) 244
RsaI GTAC 1 cut(s) 150
RsaNI GTAC 1 cut(s) 149
Sau3AI GATC 2 cut(s) 126, 241
ScaI AGTACT 1 cut(s) 150
SchI GAGTC 1 cut(s) 354
SetI ASST 5 cut(s) 84, 200, 212, 229, 364
SfcI CTRYAG 1 cut(s) 24
SmlI CTYRAG 1 cut(s) 311
SmoI CTYRAG 1 cut(s) 311
Sse9I AATT 4 cut(s) 32, 47, 236, 277
SspMI CTAG 1 cut(s) 383
TaaI ACNGT 2 cut(s) 175, 398
TaiI ACGT 2 cut(s) 84, 229
TaqI TCGA 4 cut(s) 17, 240, 244, 267
TasI AATT 4 cut(s) 32, 47, 236, 277
TatI WGTACW 1 cut(s) 148
TfiI GAWTC 2 cut(s) 19, 339
TseFI GTSAC 1 cut(s) 362
Tsp45I GTSAC 1 cut(s) 362
TspDTI ATGAA 2 cut(s) 285, 409
Van91I CCANNNNNTGG 1 cut(s) 62
XapI RAATTY 1 cut(s) 47
XbaI TCTAGA 1 cut(s) 382
XceI RCATGY 1 cut(s) 104
XcmI CCANNNNNNNNNTGG 1 cut(s) 118
XspI CTAG 1 cut(s) 383
ZraI GACGTC 1 cut(s) 82
ZrmI AGTACT 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.