Rmu_sc0001159.1_g000035

B3 domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001159.1
OG0000623
Physical Location & Seq
Forward (+)
169046 .. 169832
787 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001159.1_g000035.1.cds

Sequence Viewer

Length: 477 bp
atgacatgtgatggatcaaacaaaaagcacaaaggcttggacaaagagtcatggaaagcatttattgacgacaacaatttgaaggctggagatggatgcgtgtttgaagtcatggagtgcagcagtacaaaactagtattaagagtccaaatcctccgaggtgacatcccagctgaacttttagagaaggaaaaagaaaaccaaaactcattcacaaagcagcccctagcccgagctagccgagccttcgctgcagcccgagcgcccgtgtgcttgcaaccttgcacagcagcccctgctgcccccttcctgcagccctgcgttccagcctgctgccaccgaagcatccctgctgcgcaaacaagccaacgttggccatgggcaccactttccaacgccaccagtcctagggactatgcatattgtctggagatggatgcgtgtttgaagtcatggagtgcagcagtacaaaactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
B3

Protein Analysis

158

Amino Acids

17.32

Weight (kDa)

8.33

Isoelectric Point (pI)

64.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000623)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g35581 FvH4_6g35581 FvH4_6g35582 FvH4_7g07710 FvH4_7g07720
malus_domestica MD02G1233300.v1.1 MD07G1080300.v1.1
prunus_persica Prupe.2G100300_v2.0.a1 Prupe.2G100300_v2.0.a1 Prupe.2G100300_v2.0.a1 Prupe.2G100300_v2.0.a1 Prupe.2G104300_v2.0.a1 Prupe.2G104700_v2.0.a1 Prupe.2G104700_v2.0.a1 Prupe.2G104700_v2.0.a1
pyrus_communis pycom02g20150 pycom07g06390
rosa_chinensis RchiOBHm_Chr1g0342371 RchiOBHm_Chr1g0342381 RchiOBHm_Chr1g0342401 RchiOBHm_Chr1g0342491 RchiOBHm_Chr1g0342511 RchiOBHm_Chr2g0147401 RchiOBHm_Chr2g0147411
rosa_laevigata RLG00000020253 RLG00000020259 RLG00000029157 RLG00000029158
rosa_multiflora Rmu_sc0000979.1_g000010 Rmu_sc0001159.1_g000034 Rmu_sc0001159.1_g000035 Rmu_sc0005388.1_g000001 Rmu_sc0009535.1_g000001 Rmu_sc0009535.1_g000003 Rmu_sc0011976.1_g000004 Rmu_sc0011976.1_g000005 Rmu_sc0027133.1_g000002
rosa_roxburghii Rroxscaffold_2G00099550 Rroxscaffold_2G00099560 Rroxscaffold_4G00296180 Rroxscaffold_4G00312990 Rroxscaffold_4G00313010 Rroxscaffold_4G00313030 Rroxscaffold_4G00313060
rosa_rugosa Rorug01G0150600.1 Rorug01G0150700.1 Rorug01G0150800.1 Rorug01G0150900.1 Rorug01G0151000.1 Rorug01G0151100.1 Rorug01G0151200.1 Rorug01G0151300.1 Rorug01G0151400.1 Rorug02G0399500 Rorug02G0399600 Rorug02G0399700 Rorug02G0399800 Rorug02G0399800 Rorug02G0399900
rosa_samantha Rh1AG165800 Rh1AG165900 Rh1BG132300 Rh1BG132400 Rh1CG154400 Rh1CG154500 Rh1DG167200 Rh1DG167300 Rh2AG456600 Rh2AG456700 Rh2BG469100 Rh2CG444100 Rh2CG444200 Rh2DG478400 Rh2DG478500
rosa_wichuraiana Rw1G013810 Rw1G013820 Rw1G013860 Rw2G037370 Rw2G037380

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 357
AccB1I GGYRCC 1 cut(s) 382
AclI AACGTT 1 cut(s) 370
AclWI GGATC 1 cut(s) 22
AcoI YGGCCR 1 cut(s) 374
AfaI GTAC 2 cut(s) 127, 468
AfiI CCNNNNNNNGG 1 cut(s) 408
AflIII ACRYGT 1 cut(s) 5
AgsI TTSAA 3 cut(s) 82, 107, 448
AhdI GACNNNNNGTC 1 cut(s) 46
AhlI ACTAGT 1 cut(s) 133
AluBI AGCT 2 cut(s) 173, 236
AluI AGCT 2 cut(s) 173, 236
AlwI GGATC 1 cut(s) 22
AlwNI CAGNNNCTG 1 cut(s) 296
Ama87I CYCGRG 2 cut(s) 231, 258
AoxI GGCC 1 cut(s) 374
AspA2I CCTAGG 1 cut(s) 407
AspLEI GCGC 2 cut(s) 265, 358
AsuHPI GGTGA 1 cut(s) 173
AsuNHI GCTAGC 1 cut(s) 236
AvaI CYCGRG 2 cut(s) 231, 258
AvrII CCTAGG 1 cut(s) 407
BaeGI GKGCMC 1 cut(s) 385
BalI TGGCCA 1 cut(s) 376
BanI GGYRCC 1 cut(s) 382
BccI CCATC 3 cut(s) 5, 86, 427
BcuI ACTAGT 1 cut(s) 133
BfaI CTAG 5 cut(s) 134, 227, 237, 408, 475
BfmI CTRYAG 2 cut(s) 252, 311
BfoI RGCGCY 1 cut(s) 266
BlnI CCTAGG 1 cut(s) 407
BmeRI GACNNNNNGTC 1 cut(s) 46
BmeT110I CYCGRG 2 cut(s) 231, 258
BmiI GGNNCC 1 cut(s) 384
BmsI GCATC 3 cut(s) 86, 354, 427
BmtI GCTAGC 1 cut(s) 240
BpmI CTGGAG 2 cut(s) 108, 449
BsaJI CCNNGG 3 cut(s) 157, 377, 407
Bsc4I CCNNNNNNNGG 1 cut(s) 408
Bse1I ACTGG 1 cut(s) 402
BseDI CCNNGG 3 cut(s) 157, 377, 407
BseGI GGATG 4 cut(s) 101, 165, 345, 442
BseLI CCNNNNNNNGG 1 cut(s) 408
BseNI ACTGG 1 cut(s) 402
BseSI GKGCMC 1 cut(s) 385
BseYI CCCAGC 1 cut(s) 169
BsgI GTGCAG 1 cut(s) 139
BshFI GGCC 1 cut(s) 376
BshNI GGYRCC 1 cut(s) 382
BsiHKCI CYCGRG 2 cut(s) 231, 258
BslFI GGGAC 1 cut(s) 425
BslI CCNNNNNNNGG 1 cut(s) 408
BsmFI GGGAC 1 cut(s) 425
BsnI GGCC 1 cut(s) 376
BsoBI CYCGRG 2 cut(s) 231, 258
Bsp1286I GDGCHC 1 cut(s) 385
Bsp143I GATC 1 cut(s) 14
Bsp19I CCATGG 1 cut(s) 377
BspANI GGCC 1 cut(s) 376
BspLI GGNNCC 1 cut(s) 384
BspMAI CTGCAG 2 cut(s) 256, 315
BspOI GCTAGC 1 cut(s) 240
BspPI GGATC 1 cut(s) 22
BspT107I GGYRCC 1 cut(s) 382
BsrI ACTGG 1 cut(s) 402
BssECI CCNNGG 3 cut(s) 157, 377, 407
BssMI GATC 1 cut(s) 14
BssT1I CCWWGG 2 cut(s) 377, 407
BstAPI GCANNNNNTGC 1 cut(s) 296
BstC8I GCNNGC 3 cut(s) 238, 275, 331
BstDSI CCRYGG 1 cut(s) 377
BstF5I GGATG 4 cut(s) 101, 165, 345, 442
BstH2I RGCGCY 1 cut(s) 266
BstHHI GCGC 2 cut(s) 265, 358
BstKTI GATC 1 cut(s) 17
BstMBI GATC 1 cut(s) 14
BstMWI GCNNNNNNNGC 6 cut(s) 242, 251, 260, 296, 299, 342
BstNSI RCATGY 1 cut(s) 9
BstSFI CTRYAG 2 cut(s) 252, 311
BstSLI GKGCMC 1 cut(s) 385
BsuRI GGCC 1 cut(s) 376
BtgI CCRYGG 1 cut(s) 377
BtsCI GGATG 4 cut(s) 101, 165, 345, 442
Cac8I GCNNGC 3 cut(s) 238, 275, 331
CaiI CAGNNNCTG 1 cut(s) 296
CfoI GCGC 2 cut(s) 265, 358
Csp6I GTAC 2 cut(s) 126, 467
CviAII CATG 5 cut(s) 6, 51, 112, 378, 453
CviQI GTAC 2 cut(s) 126, 467
DpnI GATC 1 cut(s) 16
DpnII GATC 1 cut(s) 14
DriI GACNNNNNGTC 1 cut(s) 46
EaeI YGGCCR 1 cut(s) 374
Eam1105I GACNNNNNGTC 1 cut(s) 46
Eco130I CCWWGG 2 cut(s) 377, 407
Eco88I CYCGRG 2 cut(s) 231, 258
EcoT14I CCWWGG 2 cut(s) 377, 407
EcoT22I ATGCAT 1 cut(s) 421
ErhI CCWWGG 2 cut(s) 377, 407
FaeI CATG 5 cut(s) 9, 54, 115, 381, 456
FaiI YATR 7 cut(s) 7, 52, 113, 379, 417, 421, 454
FaqI GGGAC 1 cut(s) 425
FatI CATG 5 cut(s) 5, 50, 111, 377, 452
FokI GGATG 4 cut(s) 108, 152, 332, 449
FspBI CTAG 5 cut(s) 134, 227, 237, 408, 475
FspI TGCGCA 1 cut(s) 357
GlaI GCGC 2 cut(s) 264, 357
GsaI CCCAGC 1 cut(s) 173
GsuI CTGGAG 2 cut(s) 108, 449
HaeII RGCGCY 1 cut(s) 266
HaeIII GGCC 1 cut(s) 376
HhaI GCGC 2 cut(s) 265, 358
Hin1II CATG 5 cut(s) 9, 54, 115, 381, 456
Hin6I GCGC 2 cut(s) 263, 356
HinP1I GCGC 2 cut(s) 263, 356
HinfI GANTC 2 cut(s) 47, 144
HphI GGTGA 1 cut(s) 173
Hpy188I TCNGA 1 cut(s) 158
Hpy188III TCNNGA 1 cut(s) 428
HpyAV CCTTC 4 cut(s) 76, 181, 256, 316
HpyCH4IV ACGT 1 cut(s) 370
HpyCH4V TGCA 7 cut(s) 120, 254, 277, 285, 313, 419, 461
HpyF10VI GCNNNNNNNGC 6 cut(s) 242, 251, 260, 296, 299, 342
HpySE526I ACGT 1 cut(s) 370
Hsp92II CATG 5 cut(s) 9, 54, 115, 381, 456
HspAI GCGC 2 cut(s) 263, 356
Kzo9I GATC 1 cut(s) 14
LweI GCATC 3 cut(s) 86, 354, 427
MaeI CTAG 5 cut(s) 134, 227, 237, 408, 475
MaeII ACGT 1 cut(s) 370
MaeIII GTNAC 1 cut(s) 161
MalI GATC 1 cut(s) 16
MboI GATC 1 cut(s) 14
MhlI GDGCHC 1 cut(s) 385
MlsI TGGCCA 1 cut(s) 376
MluCI AATT 1 cut(s) 76
MluNI TGGCCA 1 cut(s) 376
MlyI GAGTC 2 cut(s) 56, 153
MmeI TCCRAC 1 cut(s) 417
MnlI CCTC 2 cut(s) 152, 164
Mox20I TGGCCA 1 cut(s) 376
Mph1103I ATGCAT 1 cut(s) 421
MscI TGGCCA 1 cut(s) 376
MseI TTAA 1 cut(s) 140
Msp20I TGGCCA 1 cut(s) 376
MspA1I CMGCKG 1 cut(s) 173
MwoI GCNNNNNNNGC 6 cut(s) 242, 251, 260, 296, 299, 342
NcoI CCATGG 1 cut(s) 377
NdeII GATC 1 cut(s) 14
NheI GCTAGC 1 cut(s) 236
NlaIII CATG 5 cut(s) 9, 54, 115, 381, 456
NlaIV GGNNCC 1 cut(s) 384
NmeAIII GCCGAG 1 cut(s) 266
NmuCI GTSAC 1 cut(s) 161
NsbI TGCGCA 1 cut(s) 357
NsiI ATGCAT 1 cut(s) 421
NspI RCATGY 1 cut(s) 9
PciI ACATGT 1 cut(s) 5
PleI GAGTC 2 cut(s) 55, 152
PpsI GAGTC 2 cut(s) 55, 152
PscI ACATGT 1 cut(s) 5
Psp1406I AACGTT 1 cut(s) 370
PspFI CCCAGC 1 cut(s) 169
PspN4I GGNNCC 1 cut(s) 384
PstI CTGCAG 2 cut(s) 256, 315
PstNI CAGNNNCTG 1 cut(s) 296
PvuII CAGCTG 1 cut(s) 173
RsaI GTAC 2 cut(s) 127, 468
RsaNI GTAC 2 cut(s) 126, 467
SaqAI TTAA 1 cut(s) 140
Sau3AI GATC 1 cut(s) 14
SchI GAGTC 2 cut(s) 56, 153
SduI GDGCHC 1 cut(s) 385
SetI ASST 5 cut(s) 163, 175, 238, 283, 373
SfaNI GCATC 3 cut(s) 86, 354, 427
SfcI CTRYAG 2 cut(s) 252, 311
SpeI ACTAGT 1 cut(s) 133
Sse9I AATT 1 cut(s) 76
SspMI CTAG 5 cut(s) 134, 227, 237, 408, 475
StyI CCWWGG 2 cut(s) 377, 407
TaiI ACGT 1 cut(s) 373
TasI AATT 1 cut(s) 76
TatI WGTACW 2 cut(s) 125, 466
Tru1I TTAA 1 cut(s) 140
Tru9I TTAA 1 cut(s) 140
TseFI GTSAC 1 cut(s) 161
Tsp45I GTSAC 1 cut(s) 161
XceI RCATGY 1 cut(s) 9
XmaJI CCTAGG 1 cut(s) 407
XspI CTAG 5 cut(s) 134, 227, 237, 408, 475
Zsp2I ATGCAT 1 cut(s) 421
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.