RchiOBHm_Chr1g0366981

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0001348
Physical Location & Seq
Forward (+)
57406627 .. 57407545
919 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ59149

Sequence Viewer

Length: 135 bp
ATGTCTCAACTCAAAAATTTGTTAAGAAACATTTTTGGGTACAGAGATTTGCTCAAGGCACTGTCGGATCGTGATTGTCTTAAGAACTGGCCAAGTAATATCAGAACAGGCCAAGTAATTTCGGAGAAGAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

44

Amino Acids

5.16

Weight (kDa)

10.01

Isoelectric Point (pI)

45.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 75
AcoI YGGCCR 1 cut(s) 89
AcsI RAATTY 1 cut(s) 16
AfaI GTAC 1 cut(s) 41
AflII CTTAAG 1 cut(s) 80
Alw26I GTCTC 1 cut(s) 9
AlwI GGATC 1 cut(s) 75
AoxI GGCC 2 cut(s) 89, 109
ApoI RAATTY 1 cut(s) 16
BalI TGGCCA 1 cut(s) 91
BcoDI GTCTC 1 cut(s) 9
BfrI CTTAAG 1 cut(s) 80
BplI GAGNNNNNCTC 2 cut(s) 36, 68
BpuEI CTTGAG 1 cut(s) 38
BsaXI ACNNNNNCTCC 1 cut(s) 116
Bse1I ACTGG 1 cut(s) 92
BseNI ACTGG 1 cut(s) 92
BshFI GGCC 2 cut(s) 91, 111
BsmAI GTCTC 1 cut(s) 9
BsnI GGCC 2 cut(s) 91, 111
Bsp143I GATC 1 cut(s) 67
BspANI GGCC 2 cut(s) 91, 111
BspPI GGATC 1 cut(s) 75
BspTI CTTAAG 1 cut(s) 80
BsrI ACTGG 1 cut(s) 92
BssMI GATC 1 cut(s) 67
Bst4CI ACNGT 1 cut(s) 63
BstAFI CTTAAG 1 cut(s) 80
BstKTI GATC 1 cut(s) 70
BstMAI GTCTC 1 cut(s) 9
BstMBI GATC 1 cut(s) 67
BsuRI GGCC 2 cut(s) 91, 111
BtsIMutI CAGTG 1 cut(s) 59
Csp6I GTAC 1 cut(s) 40
CviJI RGCY 2 cut(s) 91, 111
CviKI_1 RGCY 2 cut(s) 91, 111
CviQI GTAC 1 cut(s) 40
DpnI GATC 1 cut(s) 69
DpnII GATC 1 cut(s) 67
EaeI YGGCCR 1 cut(s) 89
FspEI CC 9 cut(s) 21, 22, 41, 50, 73, 93, 105, 107, 125
HaeIII GGCC 2 cut(s) 91, 111
Hpy188I TCNGA 3 cut(s) 67, 104, 124
Hpy188III TCNNGA 1 cut(s) 71
HpyCH4III ACNGT 1 cut(s) 63
Kzo9I GATC 1 cut(s) 67
LpnPI CCDG 2 cut(s) 73, 93
MalI GATC 1 cut(s) 69
MboI GATC 1 cut(s) 67
MlsI TGGCCA 1 cut(s) 91
MluCI AATT 2 cut(s) 16, 117
MluNI TGGCCA 1 cut(s) 91
MmeI TCCRAC 1 cut(s) 45
Mox20I TGGCCA 1 cut(s) 91
MscI TGGCCA 1 cut(s) 91
MseI TTAA 2 cut(s) 23, 81
Msp20I TGGCCA 1 cut(s) 91
MspCI CTTAAG 1 cut(s) 80
NdeII GATC 1 cut(s) 67
RsaI GTAC 1 cut(s) 41
RsaNI GTAC 1 cut(s) 40
SaqAI TTAA 2 cut(s) 23, 81
Sau3AI GATC 1 cut(s) 67
SgeI CNNG 6 cut(s) 67, 83, 100, 105, 120, 125
SmlI CTYRAG 2 cut(s) 53, 80
SmoI CTYRAG 2 cut(s) 53, 80
Sse9I AATT 2 cut(s) 16, 117
TaaI ACNGT 1 cut(s) 63
TasI AATT 2 cut(s) 16, 117
Tru1I TTAA 2 cut(s) 23, 81
Tru9I TTAA 2 cut(s) 23, 81
TscAI CASTG 1 cut(s) 66
TspRI CASTG 1 cut(s) 66
Vha464I CTTAAG 1 cut(s) 80
XapI RAATTY 1 cut(s) 16
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.