Rmu_co8018924.1_g000001

Belongs to the argonaute family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8018924.1
OG0001348
Physical Location & Seq
Forward (+)
1 .. 538
538 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8018924.1_g000001.1.cds

Sequence Viewer

Length: 330 bp
acggaagagcctgtatactgctggacctcttcctttccagtcgaaggagttcaaaatcactcttctggacgatgaggagggacaggctggacaagcccggcgagagagagatttcagagttgtgattaaatttgctgctcgtgctgacctgcaccatttaggtctctttttgcaagggaggatagctgatgcaccccaggaggcccttcaggttcttgacattgttctaagggagttgcctacttctaggtactgtcctgtggggcgttcattttacgaccctggcttggggagaagacaaccacttggtgagggtttggaaagctggcg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ArgoL1 ArgoL2 ArgoMid ArgoN Gly-rich_Ago1 PAZ Piwi

Protein Analysis

110

Amino Acids

12.51

Weight (kDa)

8.94

Isoelectric Point (pI)

55.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 157
AccI GTMKAC 1 cut(s) 15
AcsI RAATTY 1 cut(s) 129
AcuI CTGAAG 1 cut(s) 192
AdeI CACNNNGTG 1 cut(s) 309
AfaI GTAC 1 cut(s) 252
AfiI CCNNNNNNNGG 3 cut(s) 44, 287, 288
AgsI TTSAA 1 cut(s) 53
AjnI CCWGG 2 cut(s) 196, 281
AluBI AGCT 2 cut(s) 186, 325
AluI AGCT 2 cut(s) 186, 325
Alw26I GTCTC 1 cut(s) 168
AoxI GGCC 1 cut(s) 202
ApeKI GCWGC 1 cut(s) 135
ApoI RAATTY 1 cut(s) 129
Asp700I GAANNNNTTC 1 cut(s) 48
AspS9I GGNCC 2 cut(s) 24, 203
AsuC2I CCSGG 1 cut(s) 98
AsuHPI GGTGA 1 cut(s) 321
AvaII GGWCC 1 cut(s) 24
BauI CACGAG 1 cut(s) 139
BbsI GAAGAC 1 cut(s) 302
BbvI GCAGC 1 cut(s) 122
BciT130I CCWGG 2 cut(s) 198, 283
BcnI CCSGG 1 cut(s) 98
BcoDI GTCTC 1 cut(s) 168
BfaI CTAG 1 cut(s) 247
BfuAI ACCTGC 1 cut(s) 157
BisI GCNGC 1 cut(s) 136
BlsI GCNGC 1 cut(s) 137
Bme1390I CCNGG 3 cut(s) 98, 198, 283
Bme18I GGWCC 1 cut(s) 24
BmgT120I GGNCC 2 cut(s) 24, 203
BmrFI CCNGG 3 cut(s) 98, 198, 283
BmsI GCATC 1 cut(s) 179
BpiI GAAGAC 1 cut(s) 302
BpuMI CCSGG 1 cut(s) 98
BsaI GGTCTC 1 cut(s) 168
BsaJI CCNNGG 2 cut(s) 196, 281
Bsc4I CCNNNNNNNGG 3 cut(s) 44, 287, 288
Bse1I ACTGG 1 cut(s) 38
BseBI CCWGG 2 cut(s) 198, 283
BseDI CCNNGG 2 cut(s) 196, 281
BseLI CCNNNNNNNGG 3 cut(s) 44, 287, 288
BseNI ACTGG 1 cut(s) 38
BseRI GAGGAG 1 cut(s) 90
BseXI GCAGC 1 cut(s) 122
BsgI GTGCAG 1 cut(s) 135
BshFI GGCC 1 cut(s) 204
BsiSI CCGG 1 cut(s) 98
BslFI GGGAC 1 cut(s) 94
BslI CCNNNNNNNGG 3 cut(s) 44, 287, 288
BsmAI GTCTC 1 cut(s) 168
BsmFI GGGAC 1 cut(s) 94
BsnI GGCC 1 cut(s) 204
Bso31I GGTCTC 1 cut(s) 168
BspANI GGCC 1 cut(s) 204
BspMI ACCTGC 1 cut(s) 157
BspTNI GGTCTC 1 cut(s) 168
BsrI ACTGG 1 cut(s) 38
BssECI CCNNGG 2 cut(s) 196, 281
BssNAI GTATAC 1 cut(s) 16
BssSI CACGAG 1 cut(s) 139
Bst1107I GTATAC 1 cut(s) 16
Bst2BI CACGAG 1 cut(s) 139
Bst2UI CCWGG 2 cut(s) 198, 283
Bst4CI ACNGT 1 cut(s) 255
Bst6I CTCTTC 2 cut(s) 34, 67
BstC8I GCNNGC 1 cut(s) 327
BstDEI CTNAG 1 cut(s) 228
BstMAI GTCTC 1 cut(s) 168
BstMWI GCNNNNNNNGC 2 cut(s) 93, 141
BstNI CCWGG 2 cut(s) 198, 283
BstSCI CCNGG 3 cut(s) 96, 196, 281
BstV1I GCAGC 1 cut(s) 122
BstV2I GAAGAC 1 cut(s) 302
BstZ17I GTATAC 1 cut(s) 16
BsuRI GGCC 1 cut(s) 204
BveI ACCTGC 1 cut(s) 157
Cac8I GCNNGC 1 cut(s) 327
Cfr13I GGNCC 2 cut(s) 24, 203
Csp6I GTAC 1 cut(s) 251
CviJI RGCY 7 cut(s) 10, 87, 96, 186, 204, 286, 325
CviKI_1 RGCY 7 cut(s) 10, 87, 96, 186, 204, 286, 325
CviQI GTAC 1 cut(s) 251
DdeI CTNAG 1 cut(s) 228
DraIII CACNNNGTG 1 cut(s) 309
Eam1104I CTCTTC 2 cut(s) 34, 67
EarI CTCTTC 2 cut(s) 34, 67
Eco31I GGTCTC 1 cut(s) 168
Eco47I GGWCC 1 cut(s) 24
Eco57I CTGAAG 1 cut(s) 192
EcoO109I RGGNCCY 1 cut(s) 203
EcoRII CCWGG 2 cut(s) 196, 281
FaiI YATR 1 cut(s) 16
FaqI GGGAC 1 cut(s) 94
FblI GTMKAC 1 cut(s) 15
Fnu4HI GCNGC 1 cut(s) 136
Fsp4HI GCNGC 1 cut(s) 136
FspBI CTAG 1 cut(s) 247
GluI GCNGC 1 cut(s) 136
HaeIII GGCC 1 cut(s) 204
HapII CCGG 1 cut(s) 98
HpaII CCGG 1 cut(s) 98
HphI GGTGA 1 cut(s) 321
Hpy166II GTNNAC 1 cut(s) 16
Hpy188I TCNGA 1 cut(s) 117
Hpy188III TCNNGA 2 cut(s) 66, 216
Hpy8I GTNNAC 1 cut(s) 16
HpyAV CCTTC 2 cut(s) 38, 216
HpyCH4III ACNGT 1 cut(s) 255
HpyCH4V TGCA 3 cut(s) 152, 173, 192
HpyF10VI GCNNNNNNNGC 2 cut(s) 93, 141
HpyF3I CTNAG 1 cut(s) 228
Lsp1109I GCAGC 1 cut(s) 122
LweI GCATC 1 cut(s) 179
MaeI CTAG 1 cut(s) 247
MboII GAAGA 4 cut(s) 17, 21, 54, 307
MluCI AATT 1 cut(s) 129
MnlI CCTC 6 cut(s) 37, 68, 71, 172, 194, 305
MroXI GAANNNNTTC 1 cut(s) 48
MseI TTAA 1 cut(s) 127
MspI CCGG 1 cut(s) 98
MspR9I CCNGG 3 cut(s) 98, 198, 283
MvaI CCWGG 2 cut(s) 198, 283
MwoI GCNNNNNNNGC 2 cut(s) 93, 141
NciI CCSGG 1 cut(s) 98
PdmI GAANNNNTTC 1 cut(s) 48
PkrI GCNGC 1 cut(s) 137
Psp6I CCWGG 2 cut(s) 196, 281
PspGI CCWGG 2 cut(s) 196, 281
PspPI GGNCC 2 cut(s) 24, 203
RsaI GTAC 1 cut(s) 252
RsaNI GTAC 1 cut(s) 251
SaqAI TTAA 1 cut(s) 127
SatI GCNGC 1 cut(s) 136
Sau96I GGNCC 2 cut(s) 24, 203
ScrFI CCNGG 3 cut(s) 98, 198, 283
SetI ASST 7 cut(s) 29, 151, 164, 188, 214, 252, 327
SfaNI GCATC 1 cut(s) 179
SinI GGWCC 1 cut(s) 24
Sse9I AATT 1 cut(s) 129
SspMI CTAG 1 cut(s) 247
StyD4I CCNGG 3 cut(s) 96, 196, 281
TaaI ACNGT 1 cut(s) 255
TaqI TCGA 1 cut(s) 42
TasI AATT 1 cut(s) 129
Tru1I TTAA 1 cut(s) 127
Tru9I TTAA 1 cut(s) 127
TseI GCWGC 1 cut(s) 135
TspDTI ATGAA 1 cut(s) 259
TspGWI ACGGA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 24
XapI RAATTY 1 cut(s) 129
XmiI GTMKAC 1 cut(s) 15
XmnI GAANNNNTTC 1 cut(s) 48
XspI CTAG 1 cut(s) 247
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.