RchiOBHm_Chr2g0120411

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
33138797 .. 33141366
2570 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ49303

Sequence Viewer

Length: 171 bp
ATGGTATGGGCAGTAGCTTTTTGTTCATTGTGCTTCTCTAATCACAAGAAACACTCATATTTTAGTTTCTGCTGCAGGGAACACCATCCATTATTTGAAAAGGCTGCTCATCTTCAAGTCAGCAGTGACGGATTTGGAGTTAATTTTGGAAATCCAAAGCCAAGAGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

6.37

Weight (kDa)

8.86

Isoelectric Point (pI)

8.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 98, 116
AluBI AGCT 2 cut(s) 17, 167
AluI AGCT 2 cut(s) 17, 167
ApeKI GCWGC 2 cut(s) 72, 104
BbvI GCAGC 2 cut(s) 59, 91
BccI CCATC 1 cut(s) 93
BfmI CTRYAG 1 cut(s) 73
BisI GCNGC 2 cut(s) 73, 105
BlsI GCNGC 2 cut(s) 74, 106
BseGI GGATG 1 cut(s) 85
BseXI GCAGC 2 cut(s) 59, 91
BspMAI CTGCAG 1 cut(s) 77
BstF5I GGATG 1 cut(s) 85
BstSFI CTRYAG 1 cut(s) 73
BstV1I GCAGC 2 cut(s) 59, 91
BtsCI GGATG 1 cut(s) 85
BtsI GCAGTG 1 cut(s) 130
BtsIMutI CAGTG 1 cut(s) 130
CviJI RGCY 4 cut(s) 17, 104, 160, 167
CviKI_1 RGCY 4 cut(s) 17, 104, 160, 167
FaiI YATR 2 cut(s) 7, 58
Fnu4HI GCNGC 2 cut(s) 73, 105
FokI GGATG 1 cut(s) 72
Fsp4HI GCNGC 2 cut(s) 73, 105
FspEI CC 8 cut(s) 61, 62, 86, 98, 102, 114, 120, 132
GluI GCNGC 2 cut(s) 73, 105
HpyCH4V TGCA 1 cut(s) 75
LpnPI CCDG 1 cut(s) 61
Lsp1109I GCAGC 2 cut(s) 59, 91
MaeIII GTNAC 1 cut(s) 125
MboII GAAGA 1 cut(s) 104
MluCI AATT 1 cut(s) 142
MseI TTAA 1 cut(s) 141
NmuCI GTSAC 1 cut(s) 125
PkrI GCNGC 2 cut(s) 74, 106
PstI CTGCAG 1 cut(s) 77
SaqAI TTAA 1 cut(s) 141
SatI GCNGC 2 cut(s) 73, 105
SetI ASST 2 cut(s) 19, 169
SfcI CTRYAG 1 cut(s) 73
SgeI CNNG 3 cut(s) 58, 88, 128
Sse9I AATT 1 cut(s) 142
TasI AATT 1 cut(s) 142
Tru1I TTAA 1 cut(s) 141
Tru9I TTAA 1 cut(s) 141
TscAI CASTG 1 cut(s) 130
TseFI GTSAC 1 cut(s) 125
TseI GCWGC 2 cut(s) 72, 104
Tsp45I GTSAC 1 cut(s) 125
TspDTI ATGAA 1 cut(s) 15
TspGWI ACGGA 1 cut(s) 144
TspRI CASTG 1 cut(s) 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.