Rh1BG154700

protein At5g03900, chloroplastic-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Reverse (-)
25320268 .. 25321142
875 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG154700.1

Sequence Viewer

Length: 156 bp
ATGTACAGAGTTTGTGGAAGAGCTGATAATTTTTTTAAGGAGAAATGGCAATTCAGAAACACTAGTATTGCTAAGAGAGCAATGGTTGTTGGACTTGGTGAACTGCCAGTATTTGGGGTTCTCATTCTGAGAGGTAAAAGTTGGCATCAAACATAA

Protein Analysis

51

Amino Acids

5.94

Weight (kDa)

10.53

Isoelectric Point (pI)

22.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 113
AfaI GTAC 1 cut(s) 5
AfiI CCNNNNNNNGG 1 cut(s) 113
AhlI ACTAGT 1 cut(s) 62
AluBI AGCT 1 cut(s) 23
AluI AGCT 1 cut(s) 23
AsuHPI GGTGA 1 cut(s) 110
BcuI ACTAGT 1 cut(s) 62
BfaI CTAG 1 cut(s) 63
Bsc4I CCNNNNNNNGG 1 cut(s) 113
Bse1I ACTGG 1 cut(s) 107
Bse3DI GCAATG 1 cut(s) 87
BseLI CCNNNNNNNGG 1 cut(s) 113
BseMI GCAATG 1 cut(s) 87
BseMII CTCAG 1 cut(s) 119
BseNI ACTGG 1 cut(s) 107
BslI CCNNNNNNNGG 1 cut(s) 113
Bsp1407I TGTACA 1 cut(s) 3
BspCNI CTCAG 1 cut(s) 120
BspQI GCTCTTC 1 cut(s) 13
BsrDI GCAATG 1 cut(s) 87
BsrGI TGTACA 1 cut(s) 3
BsrI ACTGG 1 cut(s) 107
Bst6I CTCTTC 1 cut(s) 13
BstAUI TGTACA 1 cut(s) 3
BstDEI CTNAG 2 cut(s) 72, 128
BstMWI GCNNNNNNNGC 1 cut(s) 77
Csp6I GTAC 1 cut(s) 4
CviJI RGCY 1 cut(s) 23
CviKI_1 RGCY 1 cut(s) 23
CviQI GTAC 1 cut(s) 4
DdeI CTNAG 2 cut(s) 72, 128
Eam1104I CTCTTC 1 cut(s) 13
EarI CTCTTC 1 cut(s) 13
FaiI YATR 1 cut(s) 154
FspBI CTAG 1 cut(s) 63
HphI GGTGA 1 cut(s) 110
Hpy166II GTNNAC 1 cut(s) 101
Hpy188I TCNGA 2 cut(s) 56, 129
Hpy8I GTNNAC 1 cut(s) 101
HpyF10VI GCNNNNNNNGC 1 cut(s) 77
HpyF3I CTNAG 2 cut(s) 72, 128
LguI GCTCTTC 1 cut(s) 13
LpnPI CCDG 1 cut(s) 120
MaeI CTAG 1 cut(s) 63
MboII GAAGA 1 cut(s) 30
MluCI AATT 2 cut(s) 28, 50
MmeI TCCRAC 1 cut(s) 70
MnlI CCTC 1 cut(s) 125
MseI TTAA 1 cut(s) 36
MwoI GCNNNNNNNGC 1 cut(s) 77
PciSI GCTCTTC 1 cut(s) 13
PflMI CCANNNNNTGG 1 cut(s) 113
PsrI GAACNNNNNNTAC 2 cut(s) 102, 134
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
SapI GCTCTTC 1 cut(s) 13
SaqAI TTAA 1 cut(s) 36
SetI ASST 2 cut(s) 25, 136
SgeI CNNG 3 cut(s) 75, 107, 119
SpeI ACTAGT 1 cut(s) 62
Sse9I AATT 2 cut(s) 28, 50
SspMI CTAG 1 cut(s) 63
TasI AATT 2 cut(s) 28, 50
TatI WGTACW 1 cut(s) 3
Tru1I TTAA 1 cut(s) 36
Tru9I TTAA 1 cut(s) 36
Van91I CCANNNNNTGG 1 cut(s) 113
XspI CTAG 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.