RchiOBHm_Chr3g0466681

Hydrolyzes acetyl esters in homogalacturonan regions of pectin. In type I primary cell wall, galacturonic acid residues of pectin can be acetylated at the O-2 and O-3 positions. Decreasing the degree of acetylation of pectin gels in vitro alters their physical properties

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
13086514 .. 13087580
1067 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ43273

Sequence Viewer

Length: 246 bp
ATGGAAAATGGATCAAAACTTTTCTTTAGGGGACAGCTCATCTGGGAAGCAATTATGGATGAACTCTTGTCAATTGGCTTGTCAAAGTCAAAACAGGCGCTTCTTTCTGGATGCTCAGCCGGCGGGTTGGCAACTCTTATACACTGTGATGACTTTCGAGGTCTTCTACCTAGGGATTCAAGGATTCAACTGTCAAATGTCATGCCGATGCAGTTGATGGAGCTAATATGGGATGCCTATCAGTAG

Protein Analysis

81

Amino Acids

9.07

Weight (kDa)

5.12

Isoelectric Point (pI)

22.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PAE PF03283 3 - 63 7e-23 Pectinacetylesterase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 123
AclWI GGATC 1 cut(s) 19
AgsI TTSAA 2 cut(s) 180, 188
AluBI AGCT 2 cut(s) 37, 223
AluI AGCT 2 cut(s) 37, 223
AlwI GGATC 1 cut(s) 19
AspA2I CCTAGG 1 cut(s) 170
AspLEI GCGC 1 cut(s) 100
AvrII CCTAGG 1 cut(s) 170
BbsI GAAGAC 1 cut(s) 155
BccI CCATC 1 cut(s) 211
BfaI CTAG 1 cut(s) 171
BfoI RGCGCY 1 cut(s) 101
BlnI CCTAGG 1 cut(s) 170
BlpI GCTNAGC 1 cut(s) 115
BmsI GCATC 3 cut(s) 101, 198, 223
BpiI GAAGAC 1 cut(s) 155
Bpu1102I GCTNAGC 1 cut(s) 115
BsaBI GATNNNNATC 1 cut(s) 237
BsaJI CCNNGG 1 cut(s) 170
Bse118I RCCGGY 1 cut(s) 119
Bse8I GATNNNNATC 1 cut(s) 237
BseDI CCNNGG 1 cut(s) 170
BseGI GGATG 3 cut(s) 64, 116, 238
BseJI GATNNNNATC 1 cut(s) 237
BseMII CTCAG 1 cut(s) 129
BsiSI CCGG 1 cut(s) 120
BslFI GGGAC 1 cut(s) 45
BsmFI GGGAC 1 cut(s) 45
Bsp143I GATC 1 cut(s) 11
Bsp1720I GCTNAGC 1 cut(s) 115
BspACI CCGC 1 cut(s) 123
BspCNI CTCAG 1 cut(s) 128
BspPI GGATC 1 cut(s) 19
BsrFI RCCGGY 1 cut(s) 119
BssAI RCCGGY 1 cut(s) 119
BssECI CCNNGG 1 cut(s) 170
BssMI GATC 1 cut(s) 11
BssT1I CCWWGG 1 cut(s) 170
Bst4CI ACNGT 2 cut(s) 146, 192
BstC8I GCNNGC 1 cut(s) 121
BstDEI CTNAG 1 cut(s) 115
BstF5I GGATG 3 cut(s) 64, 116, 238
BstH2I RGCGCY 1 cut(s) 101
BstHHI GCGC 1 cut(s) 100
BstKTI GATC 1 cut(s) 14
BstMBI GATC 1 cut(s) 11
BstMWI GCNNNNNNNGC 1 cut(s) 120
BstV2I GAAGAC 1 cut(s) 155
BtsCI GGATG 3 cut(s) 64, 116, 238
BtsIMutI CAGTG 1 cut(s) 142
Cac8I GCNNGC 1 cut(s) 121
CfoI GCGC 1 cut(s) 100
Cfr10I RCCGGY 1 cut(s) 119
CviAII CATG 1 cut(s) 202
CviJI RGCY 4 cut(s) 37, 78, 119, 223
CviKI_1 RGCY 4 cut(s) 37, 78, 119, 223
DdeI CTNAG 1 cut(s) 115
DpnI GATC 1 cut(s) 13
DpnII GATC 1 cut(s) 11
Eco130I CCWWGG 1 cut(s) 170
EcoT14I CCWWGG 1 cut(s) 170
ErhI CCWWGG 1 cut(s) 170
FaeI CATG 1 cut(s) 205
FaiI YATR 4 cut(s) 56, 140, 203, 229
FaqI GGGAC 1 cut(s) 45
FatI CATG 1 cut(s) 201
FauI CCCGC 1 cut(s) 116
FokI GGATG 2 cut(s) 71, 123
FspBI CTAG 1 cut(s) 171
GlaI GCGC 1 cut(s) 99
HaeII RGCGCY 1 cut(s) 101
HapII CCGG 1 cut(s) 120
HhaI GCGC 1 cut(s) 100
Hin1II CATG 1 cut(s) 205
Hin6I GCGC 1 cut(s) 98
HinP1I GCGC 1 cut(s) 98
HinfI GANTC 2 cut(s) 176, 184
HpaII CCGG 1 cut(s) 120
Hpy188III TCNNGA 1 cut(s) 108
HpyCH4III ACNGT 2 cut(s) 146, 192
HpyCH4V TGCA 1 cut(s) 211
HpyF10VI GCNNNNNNNGC 1 cut(s) 120
HpyF3I CTNAG 1 cut(s) 115
Hsp92II CATG 1 cut(s) 205
HspAI GCGC 1 cut(s) 98
KroI GCCGGC 1 cut(s) 119
KroNI GCCGGC 1 cut(s) 121
Kzo9I GATC 1 cut(s) 11
LmnI GCTCC 1 cut(s) 220
LpnPI CCDG 4 cut(s) 28, 80, 93, 133
LweI GCATC 3 cut(s) 101, 198, 223
MaeI CTAG 1 cut(s) 171
MalI GATC 1 cut(s) 13
MboI GATC 1 cut(s) 11
MboII GAAGA 1 cut(s) 155
MfeI CAATTG 1 cut(s) 72
MluCI AATT 2 cut(s) 51, 72
MnlI CCTC 1 cut(s) 152
MroNI GCCGGC 1 cut(s) 119
MslI CAYNNNNRTG 2 cut(s) 147, 206
MspI CCGG 1 cut(s) 120
MunI CAATTG 1 cut(s) 72
MwoI GCNNNNNNNGC 1 cut(s) 120
NaeI GCCGGC 1 cut(s) 121
NdeII GATC 1 cut(s) 11
NgoMIV GCCGGC 1 cut(s) 119
NlaIII CATG 1 cut(s) 205
PdiI GCCGGC 1 cut(s) 121
PfeI GAWTC 2 cut(s) 176, 184
RseI CAYNNNNRTG 2 cut(s) 147, 206
Sau3AI GATC 1 cut(s) 11
SetI ASST 4 cut(s) 39, 163, 172, 225
SfaNI GCATC 3 cut(s) 101, 198, 223
SmiMI CAYNNNNRTG 2 cut(s) 147, 206
Sse9I AATT 2 cut(s) 51, 72
SsiI CCGC 1 cut(s) 123
SspMI CTAG 1 cut(s) 171
StyI CCWWGG 1 cut(s) 170
TaaI ACNGT 2 cut(s) 146, 192
TaqI TCGA 1 cut(s) 157
TasI AATT 2 cut(s) 51, 72
TfiI GAWTC 2 cut(s) 176, 184
TscAI CASTG 1 cut(s) 149
TspDTI ATGAA 1 cut(s) 75
TspRI CASTG 1 cut(s) 149
XmaJI CCTAGG 1 cut(s) 170
XspI CTAG 1 cut(s) 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.