RchiOBHm_Chr3g0490741

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
37388913 .. 37390591
1679 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ45383

Sequence Viewer

Length: 408 bp
ATGATAGACTTAGTCCAAACCCCCAGAAGAAAAACCAAGAAATTTGAAGCATCAGATTTTTTTTCTTGTTCTTTTAGCACTGGTGAAGGGAAATTTGGTTTTGATGGTTTGCGTGGTGGTAGGGATGCCTATGGGAGTACAGAAAGTGTTTTGGGACATATGCTACGCTCCAAAACAACTGACGAATGGCGGTCAATTGTAAACAATAAAATATGGGATTTACCAGAAGGAGAAAAAAGAATTTTGTCAATTTTGAAGTTGAGTTTTGATGAATTGAAACCTTCATCCTTGAAACAATGTTTTGCATATTGCTCAATGTTCTTCAAAGATTTTGATATTGAAAAGGATGACTTGATCCAACTATGGATGGCTCAGGATGGCTTCACCCTTGTCCTGACAAAAGTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

135

Amino Acids

15.51

Weight (kDa)

6.58

Isoelectric Point (pI)

42.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 190
AclWI GGATC 1 cut(s) 349
AcsI RAATTY 3 cut(s) 41, 92, 240
AfaI GTAC 1 cut(s) 139
AgsI TTSAA 6 cut(s) 47, 256, 277, 292, 325, 341
AjuI GAANNNNNNNTTGG 2 cut(s) 78, 110
AlwI GGATC 1 cut(s) 349
ApoI RAATTY 3 cut(s) 41, 92, 240
AsuHPI GGTGA 2 cut(s) 95, 376
BccI CCATC 3 cut(s) 98, 361, 371
BfaI CTAG 1 cut(s) 406
BmsI GCATC 2 cut(s) 59, 115
BoxI GACNNNNGTC 1 cut(s) 401
Bpu10I CCTNAGC 1 cut(s) 372
Bse1I ACTGG 1 cut(s) 85
BseGI GGATG 5 cut(s) 130, 284, 352, 372, 382
BseMII CTCAG 1 cut(s) 386
BseNI ACTGG 1 cut(s) 85
BslFI GGGAC 1 cut(s) 168
BsmFI GGGAC 1 cut(s) 168
Bsp143I GATC 1 cut(s) 354
BspACI CCGC 1 cut(s) 190
BspCNI CTCAG 1 cut(s) 385
BspPI GGATC 1 cut(s) 349
BsrI ACTGG 1 cut(s) 85
BssMI GATC 1 cut(s) 354
BstDEI CTNAG 2 cut(s) 10, 372
BstF5I GGATG 5 cut(s) 130, 284, 352, 372, 382
BstKTI GATC 1 cut(s) 357
BstMBI GATC 1 cut(s) 354
BstPAI GACNNNNGTC 1 cut(s) 401
BtsCI GGATG 5 cut(s) 130, 284, 352, 372, 382
BtsIMutI CAGTG 1 cut(s) 78
Csp6I GTAC 1 cut(s) 138
CviJI RGCY 2 cut(s) 371, 381
CviKI_1 RGCY 2 cut(s) 371, 381
CviQI GTAC 1 cut(s) 138
DdeI CTNAG 2 cut(s) 10, 372
DpnI GATC 1 cut(s) 356
DpnII GATC 1 cut(s) 354
FaiI YATR 6 cut(s) 132, 159, 161, 214, 307, 364
FalI AAGNNNNNCTT 2 cut(s) 335, 367
FaqI GGGAC 1 cut(s) 168
FauNDI CATATG 1 cut(s) 159
FokI GGATG 5 cut(s) 137, 271, 359, 379, 389
FspBI CTAG 1 cut(s) 406
HphI GGTGA 2 cut(s) 95, 376
Hpy166II GTNNAC 1 cut(s) 202
Hpy188I TCNGA 1 cut(s) 55
Hpy188III TCNNGA 2 cut(s) 374, 394
Hpy8I GTNNAC 1 cut(s) 202
HpyAV CCTTC 3 cut(s) 80, 221, 291
HpyCH4V TGCA 1 cut(s) 305
HpyF3I CTNAG 2 cut(s) 10, 372
Kzo9I GATC 1 cut(s) 354
LmnI GCTCC 1 cut(s) 173
LpnPI CCDG 4 cut(s) 37, 66, 237, 359
LweI GCATC 2 cut(s) 59, 115
MaeI CTAG 1 cut(s) 406
MalI GATC 1 cut(s) 356
MboI GATC 1 cut(s) 354
MboII GAAGA 2 cut(s) 39, 313
MfeI CAATTG 1 cut(s) 195
MluCI AATT 6 cut(s) 41, 92, 195, 240, 249, 272
MmeI TCCRAC 1 cut(s) 382
MunI CAATTG 1 cut(s) 195
NdeI CATATG 1 cut(s) 159
NdeII GATC 1 cut(s) 354
PflFI GACNNNGTC 1 cut(s) 11
PshAI GACNNNNGTC 1 cut(s) 401
PsyI GACNNNGTC 1 cut(s) 11
RsaI GTAC 1 cut(s) 139
RsaNI GTAC 1 cut(s) 138
Sau3AI GATC 1 cut(s) 354
SetI ASST 1 cut(s) 283
SfaNI GCATC 2 cut(s) 59, 115
Sse9I AATT 6 cut(s) 41, 92, 195, 240, 249, 272
SsiI CCGC 1 cut(s) 190
SspMI CTAG 1 cut(s) 406
TasI AATT 6 cut(s) 41, 92, 195, 240, 249, 272
TatI WGTACW 1 cut(s) 137
TscAI CASTG 1 cut(s) 85
TspDTI ATGAA 2 cut(s) 273, 285
TspRI CASTG 1 cut(s) 85
Tth111I GACNNNGTC 1 cut(s) 11
XapI RAATTY 3 cut(s) 41, 92, 240
XspI CTAG 1 cut(s) 406
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.