Rh5CG399000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
53062187 .. 53062423
237 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG399000.1

Sequence Viewer

Length: 237 bp
ATGAGGGCAATAAGGCTCCAGATCCGACATCTCCGAGCCAGCCTGGCCCATATGAACAACGAGCTTAGAGTGGAGGAAGCCCAGCTGGAAGCTCCCTTGGCTGCTTCCGAAGATTTGACCAATCGCTTGGCCGAATCTGCAAAACTGGTTTCGTTGGCTGAAAATGGAGTTCACGCCGCAAGCCTCCAAGTTGAGATGCTTTATGTAAGGGTTGCTTTTGCAGGCTGGCCCCTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

8.66

Weight (kDa)

6.26

Isoelectric Point (pI)

33.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 177
AclWI GGATC 1 cut(s) 16
AcoI YGGCCR 1 cut(s) 129
AjnI CCWGG 1 cut(s) 42
AluBI AGCT 3 cut(s) 64, 85, 92
AluI AGCT 3 cut(s) 64, 85, 92
AlwI GGATC 1 cut(s) 16
AoxI GGCC 3 cut(s) 45, 129, 227
ApeKI GCWGC 1 cut(s) 101
AspS9I GGNCC 2 cut(s) 46, 228
BbvI GCAGC 1 cut(s) 88
BciT130I CCWGG 1 cut(s) 44
BglI GCCNNNNNGGC 1 cut(s) 44
BisI GCNGC 2 cut(s) 102, 177
BlsI GCNGC 2 cut(s) 103, 178
Bme1390I CCNGG 1 cut(s) 44
BmgT120I GGNCC 2 cut(s) 46, 228
BmiI GGNNCC 2 cut(s) 17, 230
BmrFI CCNGG 1 cut(s) 44
BmsI GCATC 1 cut(s) 186
BsaJI CCNNGG 1 cut(s) 96
Bse1I ACTGG 1 cut(s) 150
BseBI CCWGG 1 cut(s) 44
BseDI CCNNGG 1 cut(s) 96
BseNI ACTGG 1 cut(s) 150
BseXI GCAGC 1 cut(s) 88
BseYI CCCAGC 1 cut(s) 81
BshFI GGCC 3 cut(s) 47, 131, 229
BsnI GGCC 3 cut(s) 47, 131, 229
Bsp143I GATC 1 cut(s) 21
BspACI CCGC 1 cut(s) 177
BspANI GGCC 3 cut(s) 47, 131, 229
BspLI GGNNCC 2 cut(s) 17, 230
BspPI GGATC 1 cut(s) 16
BsrI ACTGG 1 cut(s) 150
BssECI CCNNGG 1 cut(s) 96
BssMI GATC 1 cut(s) 21
BssT1I CCWWGG 1 cut(s) 96
Bst2UI CCWGG 1 cut(s) 44
BstC8I GCNNGC 4 cut(s) 40, 181, 223, 227
BstDEI CTNAG 1 cut(s) 65
BstKTI GATC 1 cut(s) 24
BstMBI GATC 1 cut(s) 21
BstMWI GCNNNNNNNGC 3 cut(s) 44, 98, 137
BstNI CCWGG 1 cut(s) 44
BstSCI CCNGG 1 cut(s) 42
BstV1I GCAGC 1 cut(s) 88
BstX2I RGATCY 1 cut(s) 21
BstXI CCANNNNNNTGG 1 cut(s) 127
BstYI RGATCY 1 cut(s) 21
BsuRI GGCC 3 cut(s) 47, 131, 229
Cac8I GCNNGC 4 cut(s) 40, 181, 223, 227
Cfr13I GGNCC 2 cut(s) 46, 228
DdeI CTNAG 1 cut(s) 65
DpnI GATC 1 cut(s) 23
DpnII GATC 1 cut(s) 21
EaeI YGGCCR 1 cut(s) 129
Eco130I CCWWGG 1 cut(s) 96
EcoRII CCWGG 1 cut(s) 42
EcoT14I CCWWGG 1 cut(s) 96
ErhI CCWWGG 1 cut(s) 96
FaiI YATR 3 cut(s) 51, 53, 204
FalI AAGNNNNNCTT 2 cut(s) 199, 231
FauNDI CATATG 1 cut(s) 51
Fnu4HI GCNGC 2 cut(s) 102, 177
Fsp4HI GCNGC 2 cut(s) 102, 177
GluI GCNGC 2 cut(s) 102, 177
GsaI CCCAGC 1 cut(s) 85
HaeIII GGCC 3 cut(s) 47, 131, 229
HinfI GANTC 1 cut(s) 134
Hpy166II GTNNAC 1 cut(s) 172
Hpy188I TCNGA 3 cut(s) 26, 35, 109
Hpy188III TCNNGA 1 cut(s) 19
Hpy8I GTNNAC 1 cut(s) 172
HpyCH4V TGCA 2 cut(s) 140, 221
HpyF10VI GCNNNNNNNGC 3 cut(s) 44, 98, 137
HpyF3I CTNAG 1 cut(s) 65
Kzo9I GATC 1 cut(s) 21
LmnI GCTCC 2 cut(s) 21, 97
LpnPI CCDG 9 cut(s) 29, 32, 52, 56, 71, 95, 131, 207, 211
Lsp1109I GCAGC 1 cut(s) 88
LweI GCATC 1 cut(s) 186
MalI GATC 1 cut(s) 23
MboI GATC 1 cut(s) 21
MboII GAAGA 1 cut(s) 122
MflI RGATCY 1 cut(s) 21
MmeI TCCRAC 1 cut(s) 49
MnlI CCTC 2 cut(s) 67, 194
MspA1I CMGCKG 1 cut(s) 85
MspR9I CCNGG 1 cut(s) 44
MvaI CCWGG 1 cut(s) 44
MwoI GCNNNNNNNGC 3 cut(s) 44, 98, 137
NdeI CATATG 1 cut(s) 51
NdeII GATC 1 cut(s) 21
NlaIV GGNNCC 2 cut(s) 17, 230
PfeI GAWTC 1 cut(s) 134
PkrI GCNGC 2 cut(s) 103, 178
Psp6I CCWGG 1 cut(s) 42
PspFI CCCAGC 1 cut(s) 81
PspGI CCWGG 1 cut(s) 42
PspN4I GGNNCC 2 cut(s) 17, 230
PspPI GGNCC 2 cut(s) 46, 228
PsuI RGATCY 1 cut(s) 21
PvuII CAGCTG 1 cut(s) 85
SatI GCNGC 2 cut(s) 102, 177
Sau3AI GATC 1 cut(s) 21
Sau96I GGNCC 2 cut(s) 46, 228
ScrFI CCNGG 1 cut(s) 44
SetI ASST 3 cut(s) 66, 87, 94
SfaNI GCATC 1 cut(s) 186
SsiI CCGC 1 cut(s) 177
StyD4I CCNGG 1 cut(s) 42
StyI CCWWGG 1 cut(s) 96
TauI GCSGC 1 cut(s) 179
TfiI GAWTC 1 cut(s) 134
TseI GCWGC 1 cut(s) 101
TspDTI ATGAA 1 cut(s) 68
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.