Rmu_sc0004142.1_g000006

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004142.1
Physical Location & Seq
Forward (+)
22819 .. 23226
408 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004142.1_g000006.1.cds

Sequence Viewer

Length: 408 bp
atgctatttgcatactgctcaatgctaaagagaggttccttaattgaaagagataacttgatccaactatggatggctcaaggttttctccatccttctcttgatcaccgaagcacgcaagagattgaaatggaggatgtaggcaataagtattttgatactatactggagaactccttgtttcaagatgctagaaaggatgaggatggtgttatcactgaatacaagatgcacgatcttctgcatgatcttgcaaatgaagtatccaagtgtgaaagcttgacaccagacttcaatgatgagatggatgattctgagattcaacatgttgcgtggattcctactccaaaactagagaggatgccagaaacaagtatttcaaaactgcgctcaaagtcaaatgtctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

135

Amino Acids

15.71

Weight (kDa)

4.69

Isoelectric Point (pI)

55.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 55
AflIII ACRYGT 1 cut(s) 325
AgsI TTSAA 6 cut(s) 47, 128, 185, 295, 323, 381
AluBI AGCT 1 cut(s) 279
AluI AGCT 1 cut(s) 279
AlwI GGATC 1 cut(s) 55
AspLEI GCGC 1 cut(s) 390
AsuHPI GGTGA 1 cut(s) 98
BccI CCATC 4 cut(s) 67, 99, 200, 298
BciVI GTATCC 1 cut(s) 274
BclI TGATCA 1 cut(s) 103
BfaI CTAG 3 cut(s) 192, 353, 406
BfuI GTATCC 1 cut(s) 274
BmiI GGNNCC 1 cut(s) 37
BmsI GCATC 3 cut(s) 178, 219, 351
BpmI CTGGAG 1 cut(s) 188
BpuEI CTTGAG 1 cut(s) 63
Bse1I ACTGG 1 cut(s) 171
BseGI GGATG 7 cut(s) 78, 91, 142, 205, 211, 313, 366
BseMII CTCAG 1 cut(s) 306
BseNI ACTGG 1 cut(s) 171
Bsp143I GATC 4 cut(s) 60, 103, 235, 247
BspCNI CTCAG 1 cut(s) 307
BspLI GGNNCC 1 cut(s) 37
BspPI GGATC 1 cut(s) 55
BsrI ACTGG 1 cut(s) 171
BssMI GATC 4 cut(s) 60, 103, 235, 247
BstC8I GCNNGC 1 cut(s) 116
BstDEI CTNAG 1 cut(s) 315
BstF5I GGATG 7 cut(s) 78, 91, 142, 205, 211, 313, 366
BstHHI GCGC 1 cut(s) 390
BstKTI GATC 4 cut(s) 63, 106, 238, 250
BstMBI GATC 4 cut(s) 60, 103, 235, 247
BstNSI RCATGY 1 cut(s) 329
BsuI GTATCC 1 cut(s) 274
BtsCI GGATG 7 cut(s) 78, 91, 142, 205, 211, 313, 366
BtsIMutI CAGTG 1 cut(s) 216
Cac8I GCNNGC 1 cut(s) 116
CfoI GCGC 1 cut(s) 390
CviAII CATG 2 cut(s) 245, 326
CviJI RGCY 2 cut(s) 77, 279
CviKI_1 RGCY 2 cut(s) 77, 279
DdeI CTNAG 1 cut(s) 315
DpnI GATC 4 cut(s) 62, 105, 237, 249
DpnII GATC 4 cut(s) 60, 103, 235, 247
FaeI CATG 2 cut(s) 248, 329
FaiI YATR 5 cut(s) 13, 70, 164, 246, 327
FatI CATG 2 cut(s) 244, 325
FbaI TGATCA 1 cut(s) 103
FokI GGATG 7 cut(s) 78, 85, 149, 212, 218, 320, 373
FspBI CTAG 3 cut(s) 192, 353, 406
GlaI GCGC 1 cut(s) 389
GsuI CTGGAG 1 cut(s) 188
HhaI GCGC 1 cut(s) 390
Hin1II CATG 2 cut(s) 248, 329
Hin6I GCGC 1 cut(s) 388
HinP1I GCGC 1 cut(s) 388
HindIII AAGCTT 1 cut(s) 277
HinfI GANTC 3 cut(s) 311, 319, 337
HphI GGTGA 1 cut(s) 98
Hpy188I TCNGA 1 cut(s) 316
Hpy188III TCNNGA 2 cut(s) 101, 185
HpyAV CCTTC 1 cut(s) 105
HpyCH4V TGCA 4 cut(s) 11, 232, 244, 254
HpyF3I CTNAG 1 cut(s) 315
Hsp92II CATG 2 cut(s) 248, 329
HspAI GCGC 1 cut(s) 388
Ksp22I TGATCA 1 cut(s) 103
Kzo9I GATC 4 cut(s) 60, 103, 235, 247
LpnPI CCDG 3 cut(s) 152, 300, 378
LweI GCATC 3 cut(s) 178, 219, 351
MaeI CTAG 3 cut(s) 192, 353, 406
MalI GATC 4 cut(s) 62, 105, 237, 249
MboI GATC 4 cut(s) 60, 103, 235, 247
MboII GAAGA 1 cut(s) 230
MluCI AATT 1 cut(s) 42
MmeI TCCRAC 1 cut(s) 88
MnlI CCTC 4 cut(s) 26, 127, 196, 351
MseI TTAA 1 cut(s) 41
NdeII GATC 4 cut(s) 60, 103, 235, 247
NlaIII CATG 2 cut(s) 248, 329
NlaIV GGNNCC 1 cut(s) 37
NspI RCATGY 1 cut(s) 329
PciI ACATGT 1 cut(s) 325
PfeI GAWTC 3 cut(s) 311, 319, 337
PscI ACATGT 1 cut(s) 325
PspN4I GGNNCC 1 cut(s) 37
SaqAI TTAA 1 cut(s) 41
Sau3AI GATC 4 cut(s) 60, 103, 235, 247
SetI ASST 3 cut(s) 37, 85, 281
SfaNI GCATC 3 cut(s) 178, 219, 351
SmlI CTYRAG 1 cut(s) 78
SmoI CTYRAG 1 cut(s) 78
Sse9I AATT 1 cut(s) 42
SspMI CTAG 3 cut(s) 192, 353, 406
TasI AATT 1 cut(s) 42
TfiI GAWTC 3 cut(s) 311, 319, 337
Tru1I TTAA 1 cut(s) 41
Tru9I TTAA 1 cut(s) 41
TscAI CASTG 1 cut(s) 223
TspDTI ATGAA 1 cut(s) 273
TspRI CASTG 1 cut(s) 223
XceI RCATGY 1 cut(s) 329
XspI CTAG 3 cut(s) 192, 353, 406
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.