Rh3DG134500

disease resistance

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
OG0004550
Physical Location & Seq
Reverse (-)
11416554 .. 11426167
9614 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG134500.1

Sequence Viewer

Length: 369 bp
ATGATGCGCTCTAAAAAGTGTGATGAATGGCAATCAATTGTGGAAAGTGGTATATGGAATTTACCAGAGGAAGAAAATAGAATATTGGCGATCTTGAAATTGAGTTTTGATGAATTGAAATTTCCATCATTGAAACAATGTTTTGCATACTGCTCCATGTTCATCAAAGATTTTGAATTTGAAAAGGACGACTTGATCCAACATTGGATGGCTCAAGGATGGCTTCACCCTTCTCCTAACCAAGATAATCTAGAGATGGAGGATACAGAGTTGAGTATTTGGCTCTACAATCAAGTTTTGGCCATCAAATCTAAGATCTTTTATAATATGGAATGGAACGAAAACGAGCTACAACATCTGAGGGTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03460 ko04014 map03460 map04014
Pfam Domains
Protein Families
NB-ARC

Protein Analysis

122

Amino Acids

14.78

Weight (kDa)

4.72

Isoelectric Point (pI)

48.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WHD_DRP PF23559 53 - 88 6.2e-07 Disease resistance protein Winged helix domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 324
AclWI GGATC 1 cut(s) 190
AcoI YGGCCR 1 cut(s) 300
AcsI RAATTY 3 cut(s) 58, 119, 176
AgsI TTSAA 5 cut(s) 97, 118, 133, 176, 182
AluBI AGCT 1 cut(s) 349
AluI AGCT 1 cut(s) 349
AlwI GGATC 1 cut(s) 190
AoxI GGCC 1 cut(s) 300
ApoI RAATTY 3 cut(s) 58, 119, 176
AspLEI GCGC 1 cut(s) 9
AsuHPI GGTGA 1 cut(s) 218
BalI TGGCCA 1 cut(s) 302
BccI CCATC 5 cut(s) 133, 202, 213, 250, 311
BciVI GTATCC 1 cut(s) 256
BfaI CTAG 1 cut(s) 251
BfuI GTATCC 1 cut(s) 256
BglII AGATCT 1 cut(s) 315
BpuEI CTTGAG 1 cut(s) 198
BseGI GGATG 2 cut(s) 213, 224
BseMII CTCAG 1 cut(s) 350
BshFI GGCC 1 cut(s) 302
BsnI GGCC 1 cut(s) 302
Bsp143I GATC 3 cut(s) 90, 195, 315
BspANI GGCC 1 cut(s) 302
BspCNI CTCAG 1 cut(s) 351
BspPI GGATC 1 cut(s) 190
BssMI GATC 3 cut(s) 90, 195, 315
BstDEI CTNAG 2 cut(s) 312, 359
BstF5I GGATG 2 cut(s) 213, 224
BstHHI GCGC 1 cut(s) 9
BstKTI GATC 3 cut(s) 93, 198, 318
BstMBI GATC 3 cut(s) 90, 195, 315
BstX2I RGATCY 1 cut(s) 315
BstYI RGATCY 1 cut(s) 315
BsuI GTATCC 1 cut(s) 256
BsuRI GGCC 1 cut(s) 302
BtsCI GGATG 2 cut(s) 213, 224
CfoI GCGC 1 cut(s) 9
CviAII CATG 1 cut(s) 157
CviJI RGCY 5 cut(s) 212, 223, 283, 302, 349
CviKI_1 RGCY 5 cut(s) 212, 223, 283, 302, 349
DdeI CTNAG 2 cut(s) 312, 359
DpnI GATC 3 cut(s) 92, 197, 317
DpnII GATC 3 cut(s) 90, 195, 315
EaeI YGGCCR 1 cut(s) 300
FaeI CATG 1 cut(s) 160
FaiI YATR 7 cut(s) 53, 55, 148, 158, 324, 329, 367
FalI AAGNNNNNCTT 4 cut(s) 176, 208, 207, 239
FatI CATG 1 cut(s) 156
FokI GGATG 2 cut(s) 220, 231
FspBI CTAG 1 cut(s) 251
GlaI GCGC 1 cut(s) 8
HaeIII GGCC 1 cut(s) 302
HhaI GCGC 1 cut(s) 9
Hin1II CATG 1 cut(s) 160
Hin6I GCGC 1 cut(s) 7
HinP1I GCGC 1 cut(s) 7
HphI GGTGA 1 cut(s) 218
Hpy188I TCNGA 1 cut(s) 360
Hpy188III TCNNGA 2 cut(s) 94, 251
HpyAV CCTTC 1 cut(s) 240
HpyCH4V TGCA 1 cut(s) 146
HpyF3I CTNAG 2 cut(s) 312, 359
Hsp92II CATG 1 cut(s) 160
HspAI GCGC 1 cut(s) 7
Kzo9I GATC 3 cut(s) 90, 195, 315
LmnI GCTCC 1 cut(s) 158
LpnPI CCDG 1 cut(s) 78
MaeI CTAG 1 cut(s) 251
MalI GATC 3 cut(s) 92, 197, 317
MboI GATC 3 cut(s) 90, 195, 315
MboII GAAGA 1 cut(s) 83
MfeI CAATTG 1 cut(s) 36
MflI RGATCY 1 cut(s) 315
MlsI TGGCCA 1 cut(s) 302
MluCI AATT 6 cut(s) 36, 58, 98, 113, 119, 176
MluNI TGGCCA 1 cut(s) 302
MmeI TCCRAC 1 cut(s) 223
MnlI CCTC 3 cut(s) 61, 253, 354
Mox20I TGGCCA 1 cut(s) 302
MscI TGGCCA 1 cut(s) 302
Msp20I TGGCCA 1 cut(s) 302
MunI CAATTG 1 cut(s) 36
NdeII GATC 3 cut(s) 90, 195, 315
NlaIII CATG 1 cut(s) 160
PsiI TTATAA 1 cut(s) 324
PsuI RGATCY 1 cut(s) 315
Sau3AI GATC 3 cut(s) 90, 195, 315
SetI ASST 1 cut(s) 351
SgeI CNNG 9 cut(s) 77, 106, 169, 205, 227, 254, 263, 305, 358
SmlI CTYRAG 1 cut(s) 213
SmoI CTYRAG 1 cut(s) 213
Sse9I AATT 6 cut(s) 36, 58, 98, 113, 119, 176
SspI AATATT 1 cut(s) 84
SspMI CTAG 1 cut(s) 251
TasI AATT 6 cut(s) 36, 58, 98, 113, 119, 176
TspDTI ATGAA 3 cut(s) 39, 126, 151
XapI RAATTY 3 cut(s) 58, 119, 176
XbaI TCTAGA 1 cut(s) 250
XspI CTAG 1 cut(s) 251
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.