RchiOBHm_Chr5g0036381

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
30568315 .. 30569661
1347 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ31520

Sequence Viewer

Length: 180 bp
ATGATCCCTTCCCAACAAGCATTGCATAATTGGTCCTTAGAGAAAGTGAAAAAGGTTGTTTCGTGCTCTTGTGTTGTTGTAAAAGTAAAGTTTGTTTCGTGCTCTTGTGTTGTTGTAAAAGTGTCACAAGGCACTGTGATTGCTAGAGGTCCATTTGGAACTGTATACCATGGTCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.36

Weight (kDa)

9.56

Isoelectric Point (pI)

34.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 165
Alw21I GWGCWC 2 cut(s) 68, 104
AspS9I GGNCC 2 cut(s) 33, 149
AvaII GGWCC 2 cut(s) 33, 149
Bbv12I GWGCWC 2 cut(s) 68, 104
BfaI CTAG 1 cut(s) 144
Bme18I GGWCC 2 cut(s) 33, 149
BmgT120I GGNCC 2 cut(s) 33, 149
BsaJI CCNNGG 1 cut(s) 169
Bse3DI GCAATG 1 cut(s) 20
BseDI CCNNGG 1 cut(s) 169
BseMI GCAATG 1 cut(s) 20
BsiHKAI GWGCWC 2 cut(s) 68, 104
Bsp1286I GDGCHC 2 cut(s) 68, 104
Bsp143I GATC 1 cut(s) 3
Bsp19I CCATGG 1 cut(s) 169
BsrDI GCAATG 1 cut(s) 20
BssECI CCNNGG 1 cut(s) 169
BssMI GATC 1 cut(s) 3
BssNAI GTATAC 1 cut(s) 166
BssT1I CCWWGG 1 cut(s) 169
Bst1107I GTATAC 1 cut(s) 166
Bst4CI ACNGT 2 cut(s) 136, 163
BstDEI CTNAG 1 cut(s) 37
BstDSI CCRYGG 1 cut(s) 169
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BstZ17I GTATAC 1 cut(s) 166
BtgI CCRYGG 1 cut(s) 169
BtsIMutI CAGTG 1 cut(s) 132
Cfr13I GGNCC 2 cut(s) 33, 149
CviAII CATG 1 cut(s) 170
DdeI CTNAG 1 cut(s) 37
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
Eco130I CCWWGG 1 cut(s) 169
Eco47I GGWCC 2 cut(s) 33, 149
EcoT14I CCWWGG 1 cut(s) 169
ErhI CCWWGG 1 cut(s) 169
FaeI CATG 1 cut(s) 173
FaiI YATR 3 cut(s) 27, 166, 171
FatI CATG 1 cut(s) 169
FblI GTMKAC 1 cut(s) 165
FspBI CTAG 1 cut(s) 144
Hin1II CATG 1 cut(s) 173
Hpy166II GTNNAC 1 cut(s) 166
Hpy8I GTNNAC 1 cut(s) 166
HpyAV CCTTC 1 cut(s) 18
HpyCH4III ACNGT 2 cut(s) 136, 163
HpyCH4V TGCA 1 cut(s) 25
HpyF3I CTNAG 1 cut(s) 37
Hsp92II CATG 1 cut(s) 173
Kzo9I GATC 1 cut(s) 3
MaeI CTAG 1 cut(s) 144
MaeIII GTNAC 1 cut(s) 123
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MhlI GDGCHC 2 cut(s) 68, 104
MluCI AATT 1 cut(s) 28
MnlI CCTC 1 cut(s) 140
NcoI CCATGG 1 cut(s) 169
NdeII GATC 1 cut(s) 3
NlaIII CATG 1 cut(s) 173
NmuCI GTSAC 1 cut(s) 123
PspPI GGNCC 2 cut(s) 33, 149
Sau3AI GATC 1 cut(s) 3
Sau96I GGNCC 2 cut(s) 33, 149
SduI GDGCHC 2 cut(s) 68, 104
SetI ASST 2 cut(s) 57, 151
SgeI CNNG 7 cut(s) 29, 75, 81, 111, 117, 140, 156
SinI GGWCC 2 cut(s) 33, 149
Sse9I AATT 1 cut(s) 28
SspMI CTAG 1 cut(s) 144
StyI CCWWGG 1 cut(s) 169
TaaI ACNGT 2 cut(s) 136, 163
TasI AATT 1 cut(s) 28
TscAI CASTG 1 cut(s) 139
TseFI GTSAC 1 cut(s) 123
Tsp45I GTSAC 1 cut(s) 123
TspRI CASTG 1 cut(s) 139
VpaK11BI GGWCC 2 cut(s) 33, 149
XmiI GTMKAC 1 cut(s) 165
XspI CTAG 1 cut(s) 144
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.