RchiOBHm_Chr7g0204711

disease resistance

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0004550
Physical Location & Seq
Reverse (-)
22387293 .. 22387757
465 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ18323

Sequence Viewer

Length: 465 bp
ATGATGCGTTCTAAAATGTGTGATGAATGGCAATCAATTTTGGACAGTGGTATATGGGATTTACCAGAGGAAGAAACTAGAATATTGATGATTTTGAAATTGAGTTTTGATGAATTGAAGTCTCCATTGTTGAAACAATGCTTTGCATACTGCTCCATGTTCACCAAAGATTTTGAATTTGAAAAGGACGACCTTATCCAACTTTGGATGGCTCAAGGATGGCTTCACCCTTCTCCCAACCAAAATAATTTAGAGATGGAGGACAAAGGTAACGAGTATTTTAATATTCTGTTGCAAAACTCATTTTTTCAAGATGTGAGAAGGGATAACTATGGTGACATAATCACATGCAAGATGCACGATCTTGTTCATGATCTTGCTGAACGTGTTTCAAAGTTGAAGTACTTGCACTCCCTATTTTCAAATAGAGCGGTCCTTGACAACGTACAACTCACCTGGATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03460 ko04014 map03460 map04014
Pfam Domains
Protein Families
NB-ARC

Protein Analysis

154

Amino Acids

18.39

Weight (kDa)

4.83

Isoelectric Point (pI)

53.33

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WHD_DRP PF23559 53 - 127 1.5e-26 Disease resistance protein Winged helix domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 431
AciI CCGC 1 cut(s) 431
AcsI RAATTY 1 cut(s) 176
AfaI GTAC 2 cut(s) 404, 447
AflIII ACRYGT 1 cut(s) 385
AgsI TTSAA 9 cut(s) 97, 118, 133, 176, 182, 311, 393, 400, 423
AjnI CCWGG 1 cut(s) 455
Alw26I GTCTC 1 cut(s) 126
ApoI RAATTY 1 cut(s) 176
AspS9I GGNCC 1 cut(s) 433
AsuHPI GGTGA 4 cut(s) 154, 218, 347, 445
AvaII GGWCC 1 cut(s) 433
BccI CCATC 3 cut(s) 202, 213, 250
BciT130I CCWGG 1 cut(s) 457
BcoDI GTCTC 1 cut(s) 126
BfaI CTAG 1 cut(s) 78
BmcAI AGTACT 1 cut(s) 404
Bme1390I CCNGG 1 cut(s) 457
Bme18I GGWCC 1 cut(s) 433
BmgT120I GGNCC 1 cut(s) 433
BmrFI CCNGG 1 cut(s) 457
BmsI GCATC 1 cut(s) 345
BpuEI CTTGAG 1 cut(s) 198
BsaXI ACNNNNNCTCC 2 cut(s) 395, 425
BseBI CCWGG 1 cut(s) 457
BseGI GGATG 2 cut(s) 213, 224
BsmAI GTCTC 1 cut(s) 126
Bsp143I GATC 2 cut(s) 361, 373
BspACI CCGC 1 cut(s) 431
BspHI TCATGA 1 cut(s) 370
BsrBI CCGCTC 1 cut(s) 431
BssMI GATC 2 cut(s) 361, 373
Bst2UI CCWGG 1 cut(s) 457
Bst4CI ACNGT 1 cut(s) 47
BstF5I GGATG 2 cut(s) 213, 224
BstKTI GATC 2 cut(s) 364, 376
BstMAI GTCTC 1 cut(s) 126
BstMBI GATC 2 cut(s) 361, 373
BstNI CCWGG 1 cut(s) 457
BstNSI RCATGY 1 cut(s) 351
BstSCI CCNGG 1 cut(s) 455
BtsCI GGATG 2 cut(s) 213, 224
BtsIMutI CAGTG 1 cut(s) 52
CciI TCATGA 1 cut(s) 370
Cfr13I GGNCC 1 cut(s) 433
Csp6I GTAC 2 cut(s) 403, 446
CviAII CATG 3 cut(s) 157, 348, 371
CviJI RGCY 2 cut(s) 212, 223
CviKI_1 RGCY 2 cut(s) 212, 223
CviQI GTAC 2 cut(s) 403, 446
DpnI GATC 2 cut(s) 363, 375
DpnII GATC 2 cut(s) 361, 373
Eco47I GGWCC 1 cut(s) 433
EcoRII CCWGG 1 cut(s) 455
FaeI CATG 3 cut(s) 160, 351, 374
FaiI YATR 8 cut(s) 53, 55, 148, 158, 333, 341, 349, 372
FalI AAGNNNNNCTT 2 cut(s) 207, 239
FatI CATG 3 cut(s) 156, 347, 370
FokI GGATG 2 cut(s) 220, 231
FspBI CTAG 1 cut(s) 78
Hin1II CATG 3 cut(s) 160, 351, 374
HphI GGTGA 4 cut(s) 154, 218, 347, 445
Hpy166II GTNNAC 1 cut(s) 162
Hpy188III TCNNGA 2 cut(s) 311, 371
Hpy8I GTNNAC 1 cut(s) 162
HpyAV CCTTC 2 cut(s) 240, 315
HpyCH4III ACNGT 1 cut(s) 47
HpyCH4IV ACGT 2 cut(s) 385, 444
HpyCH4V TGCA 5 cut(s) 146, 295, 351, 358, 409
HpySE526I ACGT 2 cut(s) 385, 444
Hsp92II CATG 3 cut(s) 160, 351, 374
Kzo9I GATC 2 cut(s) 361, 373
LmnI GCTCC 1 cut(s) 158
LpnPI CCDG 2 cut(s) 78, 442
LweI GCATC 1 cut(s) 345
MaeI CTAG 1 cut(s) 78
MaeII ACGT 2 cut(s) 385, 444
MaeIII GTNAC 2 cut(s) 269, 335
MalI GATC 2 cut(s) 363, 375
MbiI CCGCTC 1 cut(s) 431
MboI GATC 2 cut(s) 361, 373
MboII GAAGA 1 cut(s) 83
MluCI AATT 5 cut(s) 36, 98, 113, 176, 247
MmeI TCCRAC 1 cut(s) 223
MnlI CCTC 2 cut(s) 61, 253
MseI TTAA 2 cut(s) 282, 463
MspR9I CCNGG 1 cut(s) 457
MvaI CCWGG 1 cut(s) 457
NdeII GATC 2 cut(s) 361, 373
NlaIII CATG 3 cut(s) 160, 351, 374
NmuCI GTSAC 1 cut(s) 335
NspI RCATGY 1 cut(s) 351
PagI TCATGA 1 cut(s) 370
Psp6I CCWGG 1 cut(s) 455
PspGI CCWGG 1 cut(s) 455
PspPI GGNCC 1 cut(s) 433
RsaI GTAC 2 cut(s) 404, 447
RsaNI GTAC 2 cut(s) 403, 446
SaqAI TTAA 2 cut(s) 282, 463
Sau3AI GATC 2 cut(s) 361, 373
Sau96I GGNCC 1 cut(s) 433
ScaI AGTACT 1 cut(s) 404
ScrFI CCNGG 1 cut(s) 457
SetI ASST 5 cut(s) 195, 271, 388, 447, 458
SfaNI GCATC 1 cut(s) 345
SinI GGWCC 1 cut(s) 433
SmlI CTYRAG 1 cut(s) 213
SmoI CTYRAG 1 cut(s) 213
Sse9I AATT 5 cut(s) 36, 98, 113, 176, 247
SsiI CCGC 1 cut(s) 431
SspI AATATT 2 cut(s) 84, 286
SspMI CTAG 1 cut(s) 78
StyD4I CCNGG 1 cut(s) 455
TaaI ACNGT 1 cut(s) 47
TaiI ACGT 2 cut(s) 388, 447
TasI AATT 5 cut(s) 36, 98, 113, 176, 247
TatI WGTACW 1 cut(s) 402
Tru1I TTAA 2 cut(s) 282, 463
Tru9I TTAA 2 cut(s) 282, 463
TscAI CASTG 1 cut(s) 52
TseFI GTSAC 1 cut(s) 335
Tsp45I GTSAC 1 cut(s) 335
TspDTI ATGAA 3 cut(s) 39, 126, 359
TspRI CASTG 1 cut(s) 52
VpaK11BI GGWCC 1 cut(s) 433
XapI RAATTY 1 cut(s) 176
XceI RCATGY 1 cut(s) 351
XspI CTAG 1 cut(s) 78
ZrmI AGTACT 1 cut(s) 404
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.