Rh4BG185400

disease resistance

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
OG0004550
Physical Location & Seq
Reverse (-)
32424665 .. 32424994
330 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG185400.1

Sequence Viewer

Length: 330 bp
ATGATGCGTACTAAAAATAGTACAGAAGAATGGTTGTCAATTCAAGCAAGTCGAATATGGGAATTACCCGAAGGAGATGAAAGAATCATGTCTGTTTTAAAGTTGAGTTTTCAAAATTTGAAATCATCACTTTTGAAACAATGCTTTGCATATTGCTCAATGTTCCCAGAAGATTTCACAATTGAAAGAGAAAAGTTGATCCAACTATGGATGGCTCAGGGATTTCTCCATCCTTATCCTGGTCAGCATATGCAACAAATGGAGGATATAGGTAATGAGTATTTCAATATTTTATATCAAAACTCCTTATTCCAAGATGCTACCAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03460 ko04014 map03460 map04014
Pfam Domains
Protein Families
NB-ARC

Protein Analysis

109

Amino Acids

12.99

Weight (kDa)

5.09

Isoelectric Point (pI)

46.41

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WHD_DRP PF23559 54 - 105 1e-18 Disease resistance protein Winged helix domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 193
AcsI RAATTY 1 cut(s) 115
AfaI GTAC 2 cut(s) 10, 22
AfiI CCNNNNNNNGG 1 cut(s) 239
AgsI TTSAA 6 cut(s) 44, 113, 121, 136, 185, 286
AjnI CCWGG 1 cut(s) 238
AlwI GGATC 1 cut(s) 193
ApoI RAATTY 1 cut(s) 115
BccI CCATC 2 cut(s) 205, 237
BciT130I CCWGG 1 cut(s) 240
Bme1390I CCNGG 1 cut(s) 240
BmrFI CCNGG 1 cut(s) 240
BmsI GCATC 1 cut(s) 307
Bpu10I CCTNAGC 1 cut(s) 216
Bsc4I CCNNNNNNNGG 1 cut(s) 239
BseBI CCWGG 1 cut(s) 240
BseGI GGATG 2 cut(s) 216, 229
BseLI CCNNNNNNNGG 1 cut(s) 239
BseMII CTCAG 1 cut(s) 230
BslI CCNNNNNNNGG 1 cut(s) 239
Bsp143I GATC 1 cut(s) 198
BspCNI CTCAG 1 cut(s) 229
BspPI GGATC 1 cut(s) 193
BssMI GATC 1 cut(s) 198
Bst2UI CCWGG 1 cut(s) 240
BstDEI CTNAG 1 cut(s) 216
BstF5I GGATG 2 cut(s) 216, 229
BstKTI GATC 1 cut(s) 201
BstMBI GATC 1 cut(s) 198
BstNI CCWGG 1 cut(s) 240
BstSCI CCNGG 1 cut(s) 238
BtsCI GGATG 2 cut(s) 216, 229
Csp6I GTAC 2 cut(s) 9, 21
CviAII CATG 1 cut(s) 88
CviJI RGCY 1 cut(s) 215
CviKI_1 RGCY 1 cut(s) 215
CviQI GTAC 2 cut(s) 9, 21
DdeI CTNAG 1 cut(s) 216
DpnI GATC 1 cut(s) 200
DpnII GATC 1 cut(s) 198
DraI TTTAAA 1 cut(s) 99
EcoRII CCWGG 1 cut(s) 238
FaeI CATG 1 cut(s) 91
FaiI YATR 8 cut(s) 58, 89, 151, 208, 249, 251, 269, 295
FatI CATG 1 cut(s) 87
FauNDI CATATG 1 cut(s) 249
FokI GGATG 2 cut(s) 216, 223
Hin1II CATG 1 cut(s) 91
HinfI GANTC 1 cut(s) 84
HpyAV CCTTC 1 cut(s) 65
HpyCH4V TGCA 2 cut(s) 149, 253
HpyF3I CTNAG 1 cut(s) 216
Hsp92II CATG 1 cut(s) 91
Kzo9I GATC 1 cut(s) 198
LpnPI CCDG 4 cut(s) 180, 203, 225, 252
LweI GCATC 1 cut(s) 307
MalI GATC 1 cut(s) 200
MboI GATC 1 cut(s) 198
MboII GAAGA 2 cut(s) 38, 182
MfeI CAATTG 1 cut(s) 180
MluCI AATT 4 cut(s) 39, 62, 115, 180
MmeI TCCRAC 1 cut(s) 226
MnlI CCTC 1 cut(s) 256
MseI TTAA 1 cut(s) 98
MspR9I CCNGG 1 cut(s) 240
MunI CAATTG 1 cut(s) 180
MvaI CCWGG 1 cut(s) 240
NdeI CATATG 1 cut(s) 249
NdeII GATC 1 cut(s) 198
NlaIII CATG 1 cut(s) 91
PfeI GAWTC 1 cut(s) 84
Psp6I CCWGG 1 cut(s) 238
PspGI CCWGG 1 cut(s) 238
RsaI GTAC 2 cut(s) 10, 22
RsaNI GTAC 2 cut(s) 9, 21
SaqAI TTAA 1 cut(s) 98
Sau3AI GATC 1 cut(s) 198
ScrFI CCNGG 1 cut(s) 240
SetI ASST 1 cut(s) 274
SfaNI GCATC 1 cut(s) 307
SgeI CNNG 9 cut(s) 56, 60, 80, 100, 179, 230, 251, 252, 326
Sse9I AATT 4 cut(s) 39, 62, 115, 180
SspI AATATT 1 cut(s) 289
StyD4I CCNGG 1 cut(s) 238
TaqI TCGA 1 cut(s) 52
TasI AATT 4 cut(s) 39, 62, 115, 180
TatI WGTACW 1 cut(s) 20
TfiI GAWTC 1 cut(s) 84
Tru1I TTAA 1 cut(s) 98
Tru9I TTAA 1 cut(s) 98
TspDTI ATGAA 1 cut(s) 93
XapI RAATTY 1 cut(s) 115
XcmI CCANNNNNNNNNTGG 1 cut(s) 236
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.