Rroxscaffold_6G00393530

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Reverse (-)
13704123 .. 13706346
2224 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00393530.1

Sequence Viewer

Length: 246 bp
ATGACGATAGAGATTCCCGCGGCACTAGAGGTCCAAGAGGTGAATGAAGTGGGGCCTCTTCCTCTTGGTGACCATGTACCGTATATCGACCCGATAGCTCGAGAGTTGGGAACTTTATTAAAAGGGAGATTATCTGGTCATGTATATAAATACATACAAGTGCTTGAAGGCGATGAACTGATGAGAACCATCTGCTACGAGAAAATTTCTAGTCACTTTCCAGCAACGGGAAACCCAAGTGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

8.95

Weight (kDa)

4.84

Isoelectric Point (pI)

23.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 20
AciI CCGC 2 cut(s) 18, 20
AcsI RAATTY 1 cut(s) 204
AfaI GTAC 1 cut(s) 78
AfiI CCNNNNNNNGG 1 cut(s) 227
AgsI TTSAA 1 cut(s) 167
AluBI AGCT 1 cut(s) 98
AluI AGCT 1 cut(s) 98
Ama87I CYCGRG 1 cut(s) 99
AoxI GGCC 1 cut(s) 53
ApoI RAATTY 1 cut(s) 204
AspS9I GGNCC 2 cut(s) 31, 53
AsuHPI GGTGA 2 cut(s) 52, 80
AvaI CYCGRG 1 cut(s) 99
AvaII GGWCC 1 cut(s) 31
BccI CCATC 1 cut(s) 197
BfaI CTAG 2 cut(s) 26, 210
BisI GCNGC 1 cut(s) 21
BlsI GCNGC 1 cut(s) 22
Bme18I GGWCC 1 cut(s) 31
BmeT110I CYCGRG 1 cut(s) 99
BmgT120I GGNCC 2 cut(s) 31, 53
BmiI GGNNCC 1 cut(s) 54
BsaJI CCNNGG 1 cut(s) 18
Bsc4I CCNNNNNNNGG 1 cut(s) 227
BseDI CCNNGG 1 cut(s) 18
BseLI CCNNNNNNNGG 1 cut(s) 227
Bsh1236I CGCG 1 cut(s) 20
BshFI GGCC 1 cut(s) 55
BsiHKCI CYCGRG 1 cut(s) 99
BslI CCNNNNNNNGG 1 cut(s) 227
BsnI GGCC 1 cut(s) 55
BsoBI CYCGRG 1 cut(s) 99
BspACI CCGC 2 cut(s) 18, 20
BspANI GGCC 1 cut(s) 55
BspFNI CGCG 1 cut(s) 20
BspLI GGNNCC 1 cut(s) 54
BssECI CCNNGG 1 cut(s) 18
Bst4CI ACNGT 1 cut(s) 81
Bst6I CTCTTC 1 cut(s) 63
BstDSI CCRYGG 1 cut(s) 18
BstEII GGTNACC 1 cut(s) 68
BstFNI CGCG 1 cut(s) 20
BstPI GGTNACC 1 cut(s) 68
BstUI CGCG 1 cut(s) 20
BsuRI GGCC 1 cut(s) 55
BtgI CCRYGG 1 cut(s) 18
BtgZI GCGATG 1 cut(s) 186
Cfr13I GGNCC 2 cut(s) 31, 53
Cfr42I CCGCGG 1 cut(s) 21
Csp6I GTAC 1 cut(s) 77
CviAII CATG 2 cut(s) 74, 140
CviJI RGCY 2 cut(s) 55, 98
CviKI_1 RGCY 2 cut(s) 55, 98
CviQI GTAC 1 cut(s) 77
Eam1104I CTCTTC 1 cut(s) 63
EarI CTCTTC 1 cut(s) 63
Eco47I GGWCC 1 cut(s) 31
Eco88I CYCGRG 1 cut(s) 99
Eco91I GGTNACC 1 cut(s) 68
EcoO109I RGGNCCY 1 cut(s) 53
EcoO65I GGTNACC 1 cut(s) 68
FaeI CATG 2 cut(s) 77, 143
FaiI YATR 6 cut(s) 75, 84, 141, 145, 147, 155
FatI CATG 2 cut(s) 73, 139
FauI CCCGC 1 cut(s) 25
Fnu4HI GCNGC 1 cut(s) 21
Fsp4HI GCNGC 1 cut(s) 21
FspBI CTAG 2 cut(s) 26, 210
GluI GCNGC 1 cut(s) 21
HaeIII GGCC 1 cut(s) 55
Hin1II CATG 2 cut(s) 77, 143
HinfI GANTC 1 cut(s) 13
HphI GGTGA 2 cut(s) 52, 80
Hpy188III TCNNGA 1 cut(s) 101
HpyAV CCTTC 1 cut(s) 161
HpyCH4III ACNGT 1 cut(s) 81
Hsp92II CATG 2 cut(s) 77, 143
KspI CCGCGG 1 cut(s) 21
LpnPI CCDG 2 cut(s) 120, 234
MaeI CTAG 2 cut(s) 26, 210
MaeIII GTNAC 3 cut(s) 68, 212, 239
MboII GAAGA 1 cut(s) 50
MluCI AATT 1 cut(s) 204
MnlI CCTC 4 cut(s) 22, 31, 66, 72
MseI TTAA 1 cut(s) 119
MslI CAYNNNNRTG 1 cut(s) 158
MspA1I CMGCKG 1 cut(s) 20
MvnI CGCG 1 cut(s) 20
NlaIII CATG 2 cut(s) 77, 143
NlaIV GGNNCC 1 cut(s) 54
NmuCI GTSAC 3 cut(s) 68, 212, 239
PaeR7I CTCGAG 1 cut(s) 99
PfeI GAWTC 1 cut(s) 13
PkrI GCNGC 1 cut(s) 22
PspEI GGTNACC 1 cut(s) 68
PspN4I GGNNCC 1 cut(s) 54
PspPI GGNCC 2 cut(s) 31, 53
RsaI GTAC 1 cut(s) 78
RsaNI GTAC 1 cut(s) 77
RseI CAYNNNNRTG 1 cut(s) 158
SacII CCGCGG 1 cut(s) 21
SaqAI TTAA 1 cut(s) 119
SatI GCNGC 1 cut(s) 21
Sau96I GGNCC 2 cut(s) 31, 53
SetI ASST 3 cut(s) 33, 42, 100
Sfr274I CTCGAG 1 cut(s) 99
Sfr303I CCGCGG 1 cut(s) 21
SgrBI CCGCGG 1 cut(s) 21
SinI GGWCC 1 cut(s) 31
SlaI CTCGAG 1 cut(s) 99
SmiMI CAYNNNNRTG 1 cut(s) 158
SmlI CTYRAG 1 cut(s) 99
SmoI CTYRAG 1 cut(s) 99
Sse9I AATT 1 cut(s) 204
SsiI CCGC 2 cut(s) 18, 20
SspMI CTAG 2 cut(s) 26, 210
TaaI ACNGT 1 cut(s) 81
TaqI TCGA 2 cut(s) 87, 100
TasI AATT 1 cut(s) 204
TauI GCSGC 1 cut(s) 23
TfiI GAWTC 1 cut(s) 13
Tru1I TTAA 1 cut(s) 119
Tru9I TTAA 1 cut(s) 119
TseFI GTSAC 3 cut(s) 68, 212, 239
Tsp45I GTSAC 3 cut(s) 68, 212, 239
TspDTI ATGAA 2 cut(s) 60, 189
VpaK11BI GGWCC 1 cut(s) 31
XapI RAATTY 1 cut(s) 204
XhoI CTCGAG 1 cut(s) 99
XspI CTAG 2 cut(s) 26, 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.