Rh3DG157200

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Forward (+)
13515930 .. 13525932
10003 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG157200.1

Sequence Viewer

Length: 492 bp
ATGGCCCAAAAACTAGTGGACAAGTGGAGAATCTATCCCCAATCTTGTGGGTCGGGTATCTTCCATCCGCAACTCCATCCACATTGGTCATTGATGGATAGTCCGAGGCCTTATAAAATTTATAGAGGAGTGTTGGGAAATGTGATGCGTTCTAAAAAGTGTGATGAATGGCAATCAATTTTGGACAGTGGTATATGGGATTTACCGGAGGAAGAAAATAGAATACAGGCTATTTTGAAATTGAGTTTTGATGAACTGAAATCTCCATCATTAAAGCAATGTTTTGCATACTGCTCATTGTTCATCAAAGATTTCAAATTTGAAAAGGATGACTTGATCCAACTTTGGATGGCCCAAGGATGGCTACACCCATCTTCCGACCAAAATAATCTAGAGATGGAGGACAGGGGAGCCCCTACAAAATTAACACCCATGAGATCGGAGCCTCAGGGGACGGCCTGCTTAACGTATAGAATAGGGTCGGCCCTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

163

Amino Acids

18.89

Weight (kDa)

6.89

Isoelectric Point (pI)

48.92

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WHD_DRP PF23559 100 - 137 1.1e-07 Disease resistance protein Winged helix domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 114
AciI CCGC 1 cut(s) 68
AclWI GGATC 1 cut(s) 331
AcsI RAATTY 2 cut(s) 117, 317
AfiI CCNNNNNNNGG 1 cut(s) 360
AgsI TTSAA 3 cut(s) 238, 316, 323
AhlI ACTAGT 1 cut(s) 13
AlwI GGATC 1 cut(s) 331
AoxI GGCC 5 cut(s) 3, 107, 351, 456, 483
ApoI RAATTY 2 cut(s) 117, 317
AspS9I GGNCC 3 cut(s) 4, 352, 484
AxyI CCTNAGG 1 cut(s) 447
BanII GRGCYC 1 cut(s) 415
BccI CCATC 8 cut(s) 72, 84, 88, 274, 343, 354, 379, 391
BceAI ACGGC 1 cut(s) 471
BcuI ACTAGT 1 cut(s) 13
BfaI CTAG 2 cut(s) 14, 392
BmgT120I GGNCC 3 cut(s) 4, 352, 484
BmiI GGNNCC 2 cut(s) 412, 444
BmsI GCATC 1 cut(s) 135
BsaJI CCNNGG 2 cut(s) 104, 355
BsaWI WCCGGW 1 cut(s) 205
Bsc4I CCNNNNNNNGG 1 cut(s) 360
Bse21I CCTNAGG 1 cut(s) 447
Bse3DI GCAATG 1 cut(s) 284
BseDI CCNNGG 2 cut(s) 104, 355
BseGI GGATG 5 cut(s) 64, 76, 334, 354, 365
BseLI CCNNNNNNNGG 1 cut(s) 360
BseMI GCAATG 1 cut(s) 284
BseMII CTCAG 1 cut(s) 461
BseRI GAGGAG 1 cut(s) 141
BshFI GGCC 5 cut(s) 5, 109, 353, 458, 485
BsiSI CCGG 1 cut(s) 206
BslFI GGGAC 1 cut(s) 466
BslI CCNNNNNNNGG 1 cut(s) 360
BsmFI GGGAC 1 cut(s) 466
BsnI GGCC 5 cut(s) 5, 109, 353, 458, 485
Bsp1286I GDGCHC 1 cut(s) 415
Bsp143I GATC 2 cut(s) 336, 437
BspACI CCGC 1 cut(s) 68
BspANI GGCC 5 cut(s) 5, 109, 353, 458, 485
BspCNI CTCAG 1 cut(s) 460
BspLI GGNNCC 2 cut(s) 412, 444
BspPI GGATC 1 cut(s) 331
BsrDI GCAATG 1 cut(s) 284
BssECI CCNNGG 2 cut(s) 104, 355
BssMI GATC 2 cut(s) 336, 437
BssT1I CCWWGG 1 cut(s) 355
Bst4CI ACNGT 1 cut(s) 188
BstC8I GCNNGC 1 cut(s) 460
BstDEI CTNAG 1 cut(s) 447
BstF5I GGATG 5 cut(s) 64, 76, 334, 354, 365
BstKTI GATC 2 cut(s) 339, 440
BstMBI GATC 2 cut(s) 336, 437
BstXI CCANNNNNNTGG 1 cut(s) 47
Bsu36I CCTNAGG 1 cut(s) 447
BsuRI GGCC 5 cut(s) 5, 109, 353, 458, 485
BtsCI GGATG 5 cut(s) 64, 76, 334, 354, 365
BtsIMutI CAGTG 1 cut(s) 193
Cac8I GCNNGC 1 cut(s) 460
Cfr13I GGNCC 3 cut(s) 4, 352, 484
CviAII CATG 1 cut(s) 433
CviJI RGCY 9 cut(s) 5, 109, 230, 353, 364, 413, 445, 458, 485
CviKI_1 RGCY 9 cut(s) 5, 109, 230, 353, 364, 413, 445, 458, 485
DdeI CTNAG 1 cut(s) 447
DpnI GATC 2 cut(s) 338, 439
DpnII GATC 2 cut(s) 336, 437
Eco130I CCWWGG 1 cut(s) 355
Eco147I AGGCCT 1 cut(s) 109
Eco24I GRGCYC 1 cut(s) 415
Eco81I CCTNAGG 1 cut(s) 447
EcoT14I CCWWGG 1 cut(s) 355
EcoT38I GRGCYC 1 cut(s) 415
ErhI CCWWGG 1 cut(s) 355
FaeI CATG 1 cut(s) 436
FaiI YATR 8 cut(s) 114, 123, 194, 196, 289, 434, 471, 490
FalI AAGNNNNNCTT 2 cut(s) 317, 349
FaqI GGGAC 1 cut(s) 466
FatI CATG 1 cut(s) 432
FokI GGATG 5 cut(s) 51, 63, 341, 361, 372
FriOI GRGCYC 1 cut(s) 415
FspBI CTAG 2 cut(s) 14, 392
HaeIII GGCC 5 cut(s) 5, 109, 353, 458, 485
HapII CCGG 1 cut(s) 206
Hin1II CATG 1 cut(s) 436
HinfI GANTC 1 cut(s) 30
HpaII CCGG 1 cut(s) 206
Hpy166II GTNNAC 1 cut(s) 19
Hpy188I TCNGA 3 cut(s) 105, 379, 442
Hpy188III TCNNGA 1 cut(s) 392
Hpy8I GTNNAC 1 cut(s) 19
HpyCH4III ACNGT 1 cut(s) 188
HpyCH4IV ACGT 1 cut(s) 467
HpyCH4V TGCA 1 cut(s) 287
HpyF3I CTNAG 1 cut(s) 447
HpySE526I ACGT 1 cut(s) 467
Hsp92II CATG 1 cut(s) 436
Kzo9I GATC 2 cut(s) 336, 437
LmnI GCTCC 2 cut(s) 410, 442
LpnPI CCDG 5 cut(s) 212, 219, 391, 434, 472
LweI GCATC 1 cut(s) 135
MaeI CTAG 2 cut(s) 14, 392
MaeII ACGT 1 cut(s) 467
MalI GATC 2 cut(s) 338, 439
MboI GATC 2 cut(s) 336, 437
MboII GAAGA 3 cut(s) 52, 224, 366
MhlI GDGCHC 1 cut(s) 415
MluCI AATT 5 cut(s) 117, 177, 239, 317, 422
MmeI TCCRAC 2 cut(s) 364, 402
MnlI CCTC 5 cut(s) 99, 119, 202, 394, 456
MseI TTAA 3 cut(s) 272, 425, 464
MspI CCGG 1 cut(s) 206
NdeII GATC 2 cut(s) 336, 437
NlaIII CATG 1 cut(s) 436
NlaIV GGNNCC 2 cut(s) 412, 444
PceI AGGCCT 1 cut(s) 109
PfeI GAWTC 1 cut(s) 30
PsiI TTATAA 1 cut(s) 114
PspN4I GGNNCC 2 cut(s) 412, 444
PspPI GGNCC 3 cut(s) 4, 352, 484
SaqAI TTAA 3 cut(s) 272, 425, 464
Sau3AI GATC 2 cut(s) 336, 437
Sau96I GGNCC 3 cut(s) 4, 352, 484
SduI GDGCHC 1 cut(s) 415
SetI ASST 1 cut(s) 470
SfaNI GCATC 1 cut(s) 135
SpeI ACTAGT 1 cut(s) 13
Sse9I AATT 5 cut(s) 117, 177, 239, 317, 422
SseBI AGGCCT 1 cut(s) 109
SsiI CCGC 1 cut(s) 68
SspMI CTAG 2 cut(s) 14, 392
StuI AGGCCT 1 cut(s) 109
StyI CCWWGG 1 cut(s) 355
TaaI ACNGT 1 cut(s) 188
TaiI ACGT 1 cut(s) 470
TasI AATT 5 cut(s) 117, 177, 239, 317, 422
TfiI GAWTC 1 cut(s) 30
Tru1I TTAA 3 cut(s) 272, 425, 464
Tru9I TTAA 3 cut(s) 272, 425, 464
TscAI CASTG 1 cut(s) 193
TspDTI ATGAA 3 cut(s) 180, 267, 292
TspRI CASTG 1 cut(s) 193
XapI RAATTY 2 cut(s) 117, 317
XbaI TCTAGA 1 cut(s) 391
XspI CTAG 2 cut(s) 14, 392
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.